Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Primers used for amplifying 16S ribosomal RNA gene sequences from algal samples from Sacramento-San Joaquin Delta and Clear Lake
| Target (size) | Primer | Sequence (5′ - 3′) | Reference |
|---|---|---|---|
| 16S rDNA-ITS (1.5- 2 kb) | pA | AGAGTTTGATCCTGGCTCAG | Edwards et al. 1989 |
| B23S | CTTCGCCTCTGTGTGCCTAGGT | Lepere et al. 2000 | |
| 16S rDNA (1.5 kb) | CYA108F | ACGGGTGAGTAACRCGTRA | Urbach et al. 2001 |
| CYA16S SCYR | CTTCAYGYAGGCGAGTTGCAGC | ||
| 16S rDNA for sequencing | AlgaeIDSqF4 | CGTGCCAGCAGCCGCGGTAATACG | This study |
