Table 1.
Strains, plasmids, and primers used in this study
| Strain, plasmid, or oligonucleotide | Relevant characteristic or sequencea | Reference or source |
|---|---|---|
| Strains | ||
| Escherichia coli S17-1 | Conjugation strain | 28 |
| E. coli XL1-Blue | Transformation strain | |
| Corallococcus coralloides | Strain BO35, source of RoxACco | T. Schäberle, University of Bonn |
| Myxococcus fulvus HW1 | Source of RoxAMfu | Y. Li, Shandong University |
| Haliangium ochraceum | Source of RoxAHoc | DSMZ 14365 |
| Xanthomonas sp. 35Y (SN5065) | Growth on poly(cis-1,4-isoprene) latex, clearing zone formation | 3 |
| Xanthomonas sp. 35Y-CM | Chloramphenicol-resistant mutant of strain 35Y | 15 |
| Xanthomonas sp. 35Y-CM ΔroxA-attB (SN4114) | Chromosomal deletion of roxA, attB at former roxA site, no clearing zone formation on latex agar | 12 |
| Xanthomonas sp. 35Y-CM ΔroxA-attB/pNH1-roxA-attP (in chromosome; SN4230) | Expression of RoxA from rhamnose promoter, Kmr Cmr, clearing zone formation in the presence of rhamnose | 12 |
| Xanthomonas sp. 35Y-CM ΔroxA-attB/pNH1-roxAHoc-attP (in chromosome; SN5127) | Expression of RoxAHoc from rhamnose promoter, Kmr Cmr | This study |
| Xanthomonas sp. 35Y-CM ΔroxA-attB/pNH1-roxACco-attP (in chromosome; SN5129) | Expression of RoxACco from rhamnose promoter, Kmr Cmr | This study |
| Xanthomonas sp. 35Y-CM ΔroxA-attB/pNH1-roxAMfu-attP (in chromosome; SN5132) | Expression of RoxAMfu from rhamnose promoter, Kmr Cmr | This study |
| Plasmids | ||
| pJOE6787.1 | pBR322 ori, aphII (Kmr) mob int (phiC31 integrase) attP | J. Altenbuchner |
| pNH1 | pJOE6787.1 with rhamnose regulation genes | 12 |
| pNH1-roxAXsp | Coding sequence of roxAXsp under rhamnose promoter | 12 |
| pNH1-roxAXsp-attP (SN4230) | Coding sequence of roxAXsp under rhamnose promoter and attP site | 12 |
| pNH1-roxAHoc-attP (SN4126) | Coding sequence of roxAHoc under rhamnose promoter and attP site | This study |
| pNH1-roxAMfu-attP (SN5021) | Coding sequence of roxAMfu under rhamnose promoter and attP site | This study |
| pNH1-roxACco-attP (SN5084) | Coding sequence of roxACco under rhamnose promoter and attP site | This study |
| Oligonucleotides | ||
| NdeI-roxHoc_f | GGAATTCCATATGACGACCCGAGCGAACTTAC | |
| roxHoc-HindIII_r | CCCAAGCTTCTACAGGGTCTTGAGGTACTC | |
| NdeI-roxCco_f | GGAATTCCATATGAGACTGCGATGGAGCC | |
| roxCco-HindIII_r | CCCAAGCTTCTACAGCGTCTTCATGTACT | |
| NdeI-roxMfu_f | GGAATTCCATATGCGGCTACACTGGAGTC | |
| roxMfu-HindIII_r | CCCAAGCTTTCAGAGCGTCTTCACGTATT |
a
Underlining indicates the restriction enzyme sites.