Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Primers used in this study
| Primer | Sequence (5′–3′) | Reference | Target group |
|---|---|---|---|
| 493f | GGAATAAGGAGAGGGCAAG | 8a | MCG archaea |
| 915r | GTGCTCCCCCGCCAATTCCT | 36 | General archaea |
| 528f | CGGTAATACCAGCTCTCCGAG | 8 | MCG archaea |
| 732r | CGCGTTCTAGCCGACAGC | 8 | MCG archaea |
| 1069r | ACCTCACGGCACGAA | 37 | Group C2 archaea |
Modified from the 493 fluorescence in situ hybridization (FISH) probe described by Kubo et al. (8).
