. 2013 Nov;79(21):6655–6664. doi: 10.1128/AEM.01676-13

Table 4.

Sequence and expression characteristics of celB₂₃ fusion and its variants identified from screening of the celB_R–aac(3)-IV library

Name	5′ Fusion partner DNA sequence	Translated amino acid sequence	Max Ar^r tolerance^a	aac(3)-IV transcript level^b
celB^c	`ATGCCCAGCATAAGCCCATTTGCCGGCAAGCCGGTCGATCCGGACCGTCTTGTCAATATC`	`MPSISPFAGKPVDPDRLVNI`	1.00^d ± 0.33	1.00 ± 0.35
D2	`...T.T.CT..T................................................`	`.ST.................`	16.67 ± 1.67	1.29 ± 0.19
D3	`...T.......T.T.A.....T......................................`	`.S..IT.S............`	16.67 ± 1.67	1.32 ± 0.11
D4	`.....A.......T.......A....T..........T.......G.....C........`	`....I..T....V..G.L..`	16.67 ± 2.50	0.78 ± 0.24
D5	`...T....................C...........T....C..G...............`	`.S......R...Y.E.....`	11.33 ± 0.83	1.13 ± 0.12
D7	`...T...CT.A.........C.......G...............T...T..T........`	`.STK.....R......FF..`	16.67 ± 1.67	0.70 ± 0.18
D9	`...T...TA....T..............................................`	`.SI.I...............`	16.67 ± 1.33	1.08 ± 0.10
D10	`...A.A.......A...T.A.T......................................`	`.T..N.YS............`	12.00 ± 0.67	1.44 ± 0.08
D11	`...T.T.......A.......A...............T.......T.....T......C.`	`.S..N..T....V..C.F.T`	20.00 ± 2.50	4.74 ± 0.54
D13	`...A.A....A.....A.A..A........................A...A.....A...`	`.T.K.QIT.......H..K.`	11.67 ± 1.33	0.80 ± 0.18
D15	`...T.........T......................C.......................`	`.S..I.......H.......`	12.50 ± 1.33	0.89 ± 0.07
D17	`...T..........TG...G........................A...............`	`.S...AC.......E.....`	9.17 ± 0.83	1.39 ± 0.08
D19	`...T............A...........T.......C...AC..A....C..........`	`.S...Q...M..HHE.P...`	14.17 ± 1.65	1.84 ± 0.13
D20	`...T........................................................`	`.S..................`	13,33 ± 1.17	2.41 ± 0.13
D21	`...T.........A..T...........................................`	`.S..NL..............`	14.17 ± 1.50	1.45 ± 0.10

Max Ar^r tolerance is the maximum apramycin concentration tolerated by DH5α host cells (induction with 0.05 mM m-toluate). All values are relative to the tolerance level of the wild-type strain DH5α(pARcelB₂₃), which is arbitrarily set to 1 and corresponds to 0.06 g/liter.

All values are relative to the celB₂₃–aac(3)-IV transcript level, which is arbitrarily set to 1.

Only the region where random mutations had occurred is shown (first 60 nucleotides/first 20 amino acids).

The apramycin resistance level of the wild-type strain DH5α(pARcelB₂₃) (0.06 ± 0.02 g/liter) slightly differs from the level given in Fig. 4 (0.05 ± 0.02 g/liter; 0.05 mM m-toluate induction). This is because the experiments represent the average of different biological replicates (each experiment is performed as two individual biological replicates with a minimum of 4 technical replicates).