| Name | Start | Sense RNA sequence 5′-3′ | Region | GC% |
|---|---|---|---|---|
| NM_008175_stealth_349 | 349 | CACUGUAGUGCAGAUGGGAAAUCCU | ORF | 48 |
| NM_008175_stealth_control_349 | CACGAUCGUAGAGGUAAGUAUGCCU | 48 | ||
| NM_008175_stealth_733 | 733 | CCAAUGCCCAAUGCCAUCUGCUGUU | ORF | 52 |
| NM_008175_stealth_control_733 | CCACCCGGUAAUACCCGUCUUAGUU | 52 |
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.