Table 2.
miRNA | miRNA sequence 3′–5′ | Target genes | Position of target 3′UTR | Seed match |
---|---|---|---|---|
miR-19a | AGUCAAAACGUAUCUAAACGUGU | DMT1 | 89–95 | 7mer-1A |
miR-31 | UCGAUACGGUCGUAGAACGGA | TfR1 | 527–533 | 8mer |
miR133a | GUCGACCAACUUCCCCUGGUUU | Fn (light chain) | 114–120 | 8mer |
miR-141 | GGUCGAAAUGGUCUGUCACAAU | TfR1 | 1,462–1,468 | 7mer-m8 |
miR-145 | UCCCUAAGGACCCUUUUGACCUG | TfR1 | 1,027–1,033 | 7mer-1A |
miR-149 | CCCUCACUUCUCUGCCUCGGUCU | DMT1 | 35–41 | 7mer-m8 |
miR-182 | UCACACUCAAGAUGGUAACGGUUU | TfR1 | 810–816 | 7mer-1A |
miR-194 | AGGUGUACCUCAACGACAAUGU | TfR1 | 1,439–1,435 | 7mer-1A |
AGGUGUACCUCAACGACAAUGU | FPN1 | 21–27 | 7mer-m8 | |
miR-758 | CCAAUCACCUGGUCCAGUGUUU | TfR1 | 1,323–1,329 | 7mer-m8 |
Underlined letters are the homological sequence of miRNAs to target genes. The homology of both RNAs concerns only 7-nucleotide sequence and not the whole sequence of miRNA as is observed in siRNAs