TABLE 1.

miR-29 knockdown decreases osteoclast formation in vitro

Mature sequences of the nontargeting control (cel-miR-67) and the miR-29 family members are indicated. Divergent bases are underlined. Seed binding regions (bases 2–8) are in italics. Primary bone marrow macrophages were transfected with 50 nm anti-miR-29a, -b, or -c inhibitor or nontargeting scrambled control oligonucleotides. Cells were treated for 3–6 days with M-CSF (30 ng/ml) and RANKL (10 ng/ml). Osteoclast formation was evaluated by TRAP staining (n = 4 wells, 96-well plate).

Inhibitor	Mature miRNA sequence	Day 3	Day 4	Day 5	Day 6
Scrambled	ucacaaccuccuagaaagaguaga	5.2 ± 1.6a	21.6 ± 6.3a	46.0 ± 4.3a	203.8 ± 17.9a
miR-29a	uagcaccaucugaaaucgguua	0	0	11.0 ± 1.7	17.3 ± 1.4
miR-29b	uagcaccauuugaaaucgguua	0.7 ± 0.5	2.8 ± 1.0	10.2 ± 1.9	17.8 ± 1.9
miR-29c	uagcaccauuugaaaucaguguu	0	0	6.5 ± 2.3	17.8 ± 2.1

^a Significantly different from 29a, 29b, or 29c inhibitor (p < 0.01).