TABLE 1.
miR-29 knockdown decreases osteoclast formation in vitro
Mature sequences of the nontargeting control (cel-miR-67) and the miR-29 family members are indicated. Divergent bases are underlined. Seed binding regions (bases 2–8) are in italics. Primary bone marrow macrophages were transfected with 50 nm anti-miR-29a, -b, or -c inhibitor or nontargeting scrambled control oligonucleotides. Cells were treated for 3–6 days with M-CSF (30 ng/ml) and RANKL (10 ng/ml). Osteoclast formation was evaluated by TRAP staining (n = 4 wells, 96-well plate).
| Inhibitor | Mature miRNA sequence | Day 3 | Day 4 | Day 5 | Day 6 |
|---|---|---|---|---|---|
| Scrambled | ucacaaccuccuagaaagaguaga | 5.2 ± 1.6a | 21.6 ± 6.3a | 46.0 ± 4.3a | 203.8 ± 17.9a |
| miR-29a | uagcaccaucugaaaucgguua | 0 | 0 | 11.0 ± 1.7 | 17.3 ± 1.4 |
| miR-29b | uagcaccauuugaaaucgguua | 0.7 ± 0.5 | 2.8 ± 1.0 | 10.2 ± 1.9 | 17.8 ± 1.9 |
| miR-29c | uagcaccauuugaaaucaguguu | 0 | 0 | 6.5 ± 2.3 | 17.8 ± 2.1 |
a Significantly different from 29a, 29b, or 29c inhibitor (p < 0.01).