Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Real Time RT-PCR Primer Sequences
| Forward | Reverse | |
|---|---|---|
| Thymosin β4 | gcccctttcacatcaaagaa | tttccttcaccaacagcaa |
| PAI-1 | ccgatgggctcgagtatg | ttgtctgatgagttcagcatc |
| TGF-β1 | gcaacatgtggaactctaccagaa | gacgtcaaaagacagccactca |
| GAPDH | gagaggccctatcccaactc | gtgggtgcagcgaactttat |
