TABLE 1.
Primer | Target | Application(s) | Sequence (5′-3′) | Reference |
---|---|---|---|---|
Eub341Fa | Eubacteria (16S rDNA) | RTQ-PCR and DGGE | CCTACGGGAGGCAGCAG | 35 |
Psalt815R | Pseudoalteromonas (16S rDNA) | RTQ-PCR and DGGE | CCAGCTTCTAGTAGACATCGTT | 20 |
Univ907RC | Universal (16S rDNA) | RTQ-PCR | CCGTCAATTCCTTTGAGTTT | 41 |
26Fb | Eubacteria (16S rDNA) | Standard curve | AGAGTTTGATCCTGGCTCA | 19 |
1390Rc | Universal (16S rDNA) | Standard curve | GACGGGCGGTGTGTACAA | 50 |
The DGGE primer had a GC clamp attached to its 5′ end: 5′-CGCCCGCCGCGCCCCGCGCCCGTCCCGCCGCCCCCGCCCG-3′ (this study).
26F was formerly known as the probe EUB008.
1390R was formerly known as the probe Univ-1390-a-A-18.