Figure - PMC

Skip to main content

An official website of the United States government

Here's how you know

Here's how you know

Official websites use .gov
A .gov website belongs to an official government organization in the United States.

Secure .gov websites use HTTPS
A lock ( ) or https:// means you've safely connected to the .gov website. Share sensitive information only on official, secure websites.

View full-text article in PMC

. 2013 Aug 27;41(21):9967–9975. doi: 10.1093/nar/gkt758

Search in PMC
Search in PubMed
View in NLM Catalog
Add to search

© The Author(s) 2013. Published by Oxford University Press.

This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/3.0/), which permits unrestricted reuse, distribution, and reproduction in any medium, provided the original work is properly cited.

PMC Copyright notice

Figure 3. — Expression of two- and three-input AND gate circuits from a single plasmid. (A) Circuit 2i-AND reconstitutes TAL118, which binds the reporter. Four TAL repeats were exchanged in the N-input of 2i-Ctrl (TAL-N*), leading to reconstitution of a TALE designed to recognize a binding site that differs by 4 bp from the TAL118 binding site (tcataaaaacccccatattt). (B) Characterization of 2i-AND and 2i-Ctrl circuits by transient transfection in ES cells. For both circuits, variants with three different minimal promoters (m-pr) in the reporter part were tested (HSV, CMV-53 and CMV-74). The locations of regulatory elements in these promoter regions are indicated at the bottom of the promoter symbols. (C) Circuit 3i-AND reconstitutes TAL118, which binds the CMV-53 reporter. 3i-Ctrl1 contains the same TAL-N* part as 2i-Ctrl. 3i-Ctrl2 differs from 3i-AND by containing a premature stop codon in the intein middle part (compare with Figure 2A). (D) Characterization of 3i-AND and its control circuits in ES cells. Reporter activity in (B) and (D) is indicated by the percentage of CFP positive in all mCh-positive cells, as measured by flow cytometry. Error bars indicate standard deviation from three biological replicates.