Table 1.

Primer sequences, PCR conditions and restriction enzymes used for genotyping of the IL2 SNPs: rs6534349, rs2069762, rs3136534

SNP	Primers	Amplicon size (bp)	Annealing temperature	Restriction enzyme	Restriction fragments size (bp)
rs6534349 A/G	F: 5′CCTACTGTTTCTAGTTACTG	437	49 °C	BstNI (MvaI)	Allele A: 84 + 353
	R: 5′AGATTGGGACTATAAGACTG				Allele G: 84 + 153 + 200
rs2069762 T/G	F:5′ATTCACATGTTCAGTGTAGTTCTA	229	50 °C	BfaI (FspBI)	Allele T: 229
	R: 5′TCCTCTTCTGATGACTCTTTG				Allele G: 22 + 207
rs3136534 A/C	F: 5′GCCAAGGCTCTAGGTGAACA	359	57 °C	PsuI (BstYI)	Allele A: 359
	R: 5′CAAGCTCTGCCTACCAGGTT				Allele C: 87 + 272

The forward primer of the rs2069762 was modified (T→C) in order to include a BfaI restriction site