Table 1.

Trichoderma reesei repertoire of PKS-encoding genes, their most closely related orthologs for which products or functions have been identified, and the primers and annealing temperatures used for the expression analysis

Protein IDa	Nameb	R or NR and clade(s)	No. of amino acids	PKS	Identity (%)	E-value	Accession no.(s)	NCBI Blastp identification	Reference(s) or source	Forward/reverse primers (5′–3′)	Tm (°C)
Tr82208	PKS4	NR clade I	2,146	Yellow-green conidial pigment polyketide synthase	47	0.0	ACJ13039	alb1 from Aspergillus fumigatus	28	CCAGCAGACAGATACAAC/AACAGTCCAGGCTCATTA	54
Tr81964	PKS8	NR clade I, II	1,863	Uncharacterized protein	47	0.0	JN257714	adaA from A. niger or vrtA from Penicillium aethiopicum involved in anthracenone and naphthacenedione production, respectively	29, 30	ATAACACTGGCGTCACAT/CAATCAGCACAGCAATCTC	54.7
Tr105804	PKS3	NR clade III	2,116	PKS involved in lipid metabolism	54	0.0	XP_003719468	PKS16 from Botryotinia fuckeliana	Botrytis cinerea T4 Genome Consortium	CCGTATCTCTGCTGTATC/GTGAACCATCTTGAAGGA	NAc
Tr73621	Singlet, PKS1S	NR clade III	2,633	Uncharacterized protein	37	0.0	EGE04288	Phenolpthiocerol synthesis (ppsB) from Trichophyton equinum	Trichophyton equinum CBS 127.97 Genome Consortium	AGCATAAGCGGAATACATC/AGCCTGAGAAGAGTTGAT	50.2
Tr65172	PKS1	RD clade I, lovastatin/citrinin diketide	2,598	Uncharacterized lovastatin/citrinin-like diketide synthase	35/40	0.0/2E-93	BAC20566/AAP32477	MlcB from P. citrinum synthesizes diketide portion of lovastatin/PKS for ochratoxin A from A. ochraceus	31, 32	AACATCAATCTCAACATC/ACACATCGGTATAAGTATA	57
Tr65891	PKS2		2,374		37	0.0	ELQ36243	6-Methylsalicylic acid synthase from Magnaporthe oryzae	33	GGACATATTCAACAGGATTCTC/GGTGGCAACATCTTCAAG	54
Tr60118	PKS6		2,415		46	0.0	AAR90259	Uncharacterized PKS from Cochliobolus heterostrophus	5	TCAAGTGGTCTCCTCTATT/AATGTGCTGTCTCAATCC	54.7
Tr106272	PKS9		2,612		54	0.0	AAR92209	Uncharacterized PKS2 from Gibberella moniliformis	5	CCGTATCTCTGCTGTATC/ATCGTCTGTGATGAAGTG	54.7
Tr73618	Singlet, PKS2S		2,567		41/40	0.0	BAC20566/AAD34559	MlcB from P. citrinum and LovF from A. terreus synthesize diketide portion of lovastatin and citrinin, respectively	31, 34	TACCATTACACAGACTTG/AGCAATCACAACATCATA	50.2
Tr59482	PKS5	RD clade III, T-toxin	2,205	Uncharacterized T-toxin-like synthase	34	0.0	ABB76806	PKS1 and PKS2 of C. heterostrophus required for synthesis of T-toxin	35	TCTCATTGATGCGTGGTA/GCTTGGACTCTCATTCATATC	57
Tr65116	PKS7	RD clade IV, fumonisins	2,434	Uncharacterized fumonisin-like synthase	40	0.0	ELQ64206	Mycocerosic acid synthase from M. oryzae	33	AAGAAGATGTCCGCAACT/AAGCACTCATACACAACCT	NA

^aAccording to the JGI genome portal (http://genome.jgi-psf.org/Trire2/Trire2.home.html).

^bBased on the PKS grouping of Baker et al. (6).

^cNA, not available.