Fig. 9.

A: in a gel mobility shift assay, a double-stranded IRdye 700-labeled oligonucleotide containing the sequence GAGATGGGGTATCCCTATGT (DNMT1-WT) and HeLa nuclear extract provided by the kit were used. One prominent complex was detected (lane 2). Competition experiments with unlabeled DNMT1-WT oligonucleotide significantly reduced binding (lane 3); however, addition of the mutant oligonucleotide GAGATGAGGTATCAATATGT (DNMT1-MUT, lane 4) had no effect on binding. These data suggest that NF-κB binds to the site GGGGTATCCC at the DNMT1 promoter. B: in a supershift assay with a NF-κB1 P50 antibody, the supershifted band was observed with NF-κB1 P50 antibody but not with immunoglobulin G, suggesting that NF-κB1 p50 binds to the binding element at DNMT1 promoter.