Table 2.
Primers for human FKN 3’-UTR and its mutated fragments
| Gene names | Primers [5’-3’] |
|---|---|
| FKN 3’-UTR | Forward: tgggatccctcatcctcata |
| Reverse: ccagcagcagaggagagttt | |
| FKN 3’-UTR-mut | Forward: ctgagctgggatgattggag |
| Reverse: cagccagtaacggaggagag |
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.