Table 1.

Pseudo attP sites in pig kidney PK15 cell line

Site	Sequencea,b	Identity to attP (%)c	Genomic location	Integration frequencyd
attP	CCCCAACTGGGGTAACCTTTGAGTTCTCTCAGTTGGGGG	100
5113	AAGGATTTGGATTTCATC TGT GTATGCTCAGTACTTTTT	18	Chr1, ﹢ , 114220089–114220127,Int.Ge	2/6 = 33%
5156	TGGATTTGGGTGCCACGG TGA CTCAGATGGGATGCCGGG	26	Chr7, ﹣ , 45581124–45581162,Int.G	2/6 = 33%
1015	GCCTGGTATCATCAAACA TTTATGGGATCTCTGCCATGT	23	Chr9, ﹣ , 42746366–42746404,Int.G	1/6 = 17%
2015	ATACCCCCAATATAGCTC TGAAATACCAATGGGTGTTCC	31	Chr3, ﹣ , 54698718–54698756,Int.G	1/6 = 17%

^aThe TTG core in the wild-type attP site and similar core in pseudo attP site of pig genome are shown in bold.

^bNucleotides identical to the wild-type site at that position are underlined.

^cThe identity is calculated by Bioedit.

^dIntegration frequency = recombination clones/total selected clones × 100%.

^eInt.G, intergenic region.