Table 1.
Strains, plasmids and primers used in this study
| Name | Description | Reference or source |
|---|---|---|
|
Strains |
|
|
|
Clostridium acetobutylicum |
|
ATCC #824 |
|
E. coli MG1655 |
F- LAM- rph-1 |
CGSC #6300 |
|
E. coli B |
F- |
CGSC #5713 |
|
E. coli DH5α |
F- Φ80lacZΔM15 Δ(lacZYA-argF) U169 recA1 endA1 hsdR17 (rK–, mK+) phoA supE44 λ– thi-1 gyrA96 relA1 |
Invitrogen |
|
E. coli M15 |
F- thi lac mtl, pREP4 plasmid |
Qiagen |
|
E. coli BW25113 |
rrnB DElacZ4787 HsdR514 DE(araBAD)567 DE(rhaBAD)568 rph-1 |
CGSC #7636 |
|
E. coli ΔfadD |
BW25113, ΔfadD :: FRT-kan-FRT |
CGSC #9503 |
|
E. coli ΔadhE |
BW25113, Δadhe ::FRT-kan-FRT |
CGSC #9113 |
|
E. coli ΔfrdA |
BW25113, ΔfrdA :: FRT-kan-FRT |
CGSC #10964 |
|
Plasmids | ||
| pQE30 |
bla, cloning vector |
Qiagen |
| pQE-adhE2 |
pQE30 with adhe2 gene from C. acetobutylicum cloned between BamHI and SalI sites |
This study |
| pQE-ptb/buk |
pQE30 with ptb-buk operon from C. acetobutylicum cloned between SalI and PstI sites |
This study |
| pQE-adhE2/ptb/buk |
pQE-adhE2 with ptb-buk operon from C. acetobutylicum cloned between SalI and PstI sites |
This study |
|
Primers* | ||
| P1 |
ATCGGATCCATGAAAGTTACAAATCAAAAA |
This study |
| P2 |
ACTGGTCGACTTAGTGGTGGTGGTGGTGGTGAAATGATTTTATATAGATATC |
This study |
| P3 |
ACTGGTCGACGAAGGAGATATACCATGATTAAGAGTTTTAATGAAAT |
This study |
| P4 | GTCTGCAGTTAGTGGTGGTGGTGGTGGTGTTTGTATTCCTTAGCTTTTTC | This study |
*Italicized nucleotides in the primers denote restriction enzyme sites.