Table 4.
Three of human encoded miRNA sequences used in this study as examples
| miRNA | Sequence |
|---|---|
| >hsa-miR-576-3p MIMAT0004796 | AAGAUGUGGAAAAAUUGGAAUC |
| >hsa-miR-194* MIMAT0004671 | CCAGUGGGGCUGCUGUUAUCUG |
| >hsa-miR-140-5p MIMAT0000431 | CAGUGGUUUUACCCUAUGGUAG |
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.