Table 1.
Strains, plasmids and oligonucleotides used in this study
| Strains, plasmids and primers | Description | Reference or source |
|---|---|---|
|
Strains |
|
|
| SL1344 |
Salmonella enterica serovar Typhimurium wild type |
Our collection |
| ∆sscA |
SL1344, deletion of sscA |
This study |
| ∆sseC |
SL1344, deletion of sseC |
This study |
| SL1344 RES |
SL1344, ushA::Cm; CmR (10 μg/ml) |
[29] |
|
Plasmids |
|
|
| pKD4 |
oriRγ, KanR cassette flanked by FRT sites |
[26] |
| pKD46 |
RepA1019(Ts), λ, γ, β and exo expressed from ParaBAD, AmpR |
[26] |
| pFLAG-CTC |
Cytoplasmic expression of C-terminal FLAG fusion protein under control of the Ptac, AmpR |
Sigma |
| psscA-FLAG |
pFLAG-CTC, expresses in-frame fusion of SscA-FLAG |
This study |
| psseC-FLAG |
pFLAG-CTC, expresses in-frame fusion of SseC-FLAG |
This study |
| pACYC184 |
General cloning, TetR, CmR |
Our collection |
| psscA-6His |
pACYC; expresses in-frame fusion of SscA-6His |
This study |
| pBAD24 |
Arabinose-inducible gene expression, pBR322ori, PBAD, rrnBT1,2, araC, AmpR |
[27] |
| psscA |
sseA-sscA with endogenous sseA promoter in pWSK29, pSC101ori, AmpR |
This study |
|
Primers |
|
|
|
sseC lambda-F |
cgaattcacagtaatagcgacagcgccgcaggagtaaccgccttaacacagtgtaggctggagctgcttcg |
|
|
sseC lambda-R |
gcgatagccagctattctcgcctgaacgctactatagtgatcaatggtatcatatgaatatcctcctta |
|
|
sscA lambda-F |
gacccgaccctacaacaggcacatgacacgatgcggtttttccggcgtgggtgtaggctggagctgcttcg |
|
|
sscA lambda-R |
gtcagaaagttgctgtaacatcttttctgcacgctgtcggagaatttgatcatatgaatatcctcctta |
|
|
sscA-FLAG-F |
gcttaaagcttatgaaaaaagacccgaccct |
|
|
sscA-FLAG-R |
tatctgtcgacgctcctgtcagaaagttgct |
|
|
sseC-FLAG-F |
ggtcacatatgatgaatcgaattcacagtaa |
|
|
sseC-FLAG-R |
ggtcagtcgacagcgcgatagccagctattc |
|
|
sscA-HIS-F |
gtcaggctagcaggaggatgcatcaccatcaccatcacatgaaaaaagacccgaccc |
|
|
sscA-HIS-R |
gtcagaagcttttagctcctgtcagaaagttg |
|
|
sscA-F |
acgcgtcgacacaggatccgcagcaatatc |
|
| sscA-R | gctctagacccctaaatatgcaggctca |