Table 1.
Primer sequences for H. contortus beta-tubulin isotype 1 and 2 PCRs, and sequencing across the 198 and 200 SNP positions of isotype 1 in the forward and reverse directions.
| Purpose | Sequence 5′–3′ | Expected product size |
|---|---|---|
| PCR | ||
| Pooled larvae | ||
| Isotype 1 forward | TTCTGGACCGTATGGACAG | 895 |
| Isotype 1 reverse | GTAAGCTCAGCAACTGTCGAA | |
| Isotype 2 forward | GCTCCGGACCTTTTGGTGCT | 2176 |
| Isotype 2 reverse | CGTGAGCTCAGAAACAGTTAGT | |
| Single larvae | ||
| Isotype 1 forward | CTAGTTGATAACGTATTAGACGTTGTC | 791 |
| Isotype 1 reverse | GTAAGCTCAGCAACTGTCGAA | |
| Sequencing | ||
| Isotype 1 forward | GAGGCACTGGATCTGGAATG | – |
| Isotype 1 reverse | TCTCCATAGGTTGGATTTGTGAG | – |