Table 1. Description and characteristics of the group-specific real-time (q)PCR primers ‘total bacteria’ targeting the domain Bacteria, ‘Luteolibacter’ and ‘Candidatus genus Rhizospheria’, targeting Verrucomicrobium subdivision 1 groups of Luteolibacter and Candidatus genus Rhizospheria, ‘subdivisions 1, 3, 4, 6 acidobacteria and Holophaga’ representing, respectively, Acidobacteria subdivisions 1, 3, 4, 6 and Holophagae.
| Taxa | Target group | Sense | Primer sequence (5’ – 3’) | Primer name | Tm (°C)a | Amplicon length (bpb) | Aec (%) | Drd | Reference |
|---|---|---|---|---|---|---|---|---|---|
| Bacteria | total bacteria | Forward | ACTCCTACGGGAGGCAGCAG | Eub338 | 57.6 | 200 | 1.91 | 4.17 to 9.17 | [37] |
| Reverse | ATTACCGCGGCTGCTGG | Eub518 | 54.4 | [38] | |||||
| Verrocumicrobia subdivision 1 | Luteolibacter | Forward | CAGCTCGTGTCGTGAGATGT | VS1Af | 60.0 | 199 | 1.98 | 2.26 to 8.26 | [32] |
| Reverse | TCTCGGTTCTCATTGTGCTG | VS1Ar | 60.0 | ||||||
| Candidatus genus Rhizospheria | Forward | GCCCGACAGGGTTGATAGTA | VS1Bf | 60.0 | 83 | 1.95 | 2.45 to 8.45 | [32] | |
| Reverse | CGCTTGGGACCTTCGTATTA | VS1Br | 60.1 | ||||||
| Acidobacteria | subdivision 1 | Forward | CAGGTACCCAATCCTGTCGT | Acg1f | 59.8 | 83 | 98 | 4.21 to 9.21 | This study |
| Reverse | CCTTTGAGTTTCAGCCTTGC | Acg1r | 60.0 | ||||||
| subdivision 3 | Forward | TAGGCGGTTGGGTAAGTTTG | Acg3f | 60.0 | 100 | 96 | 4.28 to 7.28 | This study | |
| Reverse | AGGAATTCCGCTTTCCTCTC | Acg3r | 59.8 | ||||||
| subdivision 4 | Forward | GCACGGGTGAGTAACACGTAA | Acg4f | 61.0 | 86 | 96 | 3.74 to 8.74 | This study | |
| Reverse | CGCTGCATTATGCGGTATTA | Acg4r | 59.7 | ||||||
| subdivision 6 | Forward | GAGGTAATGGCTCACCAAGG | Acg6f | 59.6 | 193 | 96 | 4.42 to 8.42 | This study | |
| Reverse | GTCCCGTTCGACAGGAGTT | Acg6r | 60.1 | ||||||
| Holophagae | Forward | TGGGATGTTGATGGTGAAAC | Acg8f | 59.2 | 470 | 2.01 | 2.54 to 7.54 | [32] | |
| Reverse | AGTCTCGGATGCAGTTCCTG | Acg8r | 60.4 |
a Tm, melting temperature
b bp, base pairs.
c Ae, amplification efficiency. The efficiency of the reaction was calculated by the following equation: Ae = 10(-1/slope); where ‘slope’ is the slope of the standard curve.
d Theoretical dynamic range (log ceq per ml) - the range of initial template concentrations over which reliable Ct values were obtained.