Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
| Target | Probe | Sequence (5' to 3') |
|---|---|---|
| Bacteroides – Prevotella cluster | Bac303 | CCAATGTGGGGGACCTT 1 |
| Clostridium perfringens | Cperf191 | GTAGTAAGTTGGTTTCCTCG2 |
| Enterobacteriaceae | Enter1432 | CTTTTGCAACCCACT3 |
| Lactobacillus sp./Enterococcus sp. | Lab158 | GGTATTAGCAYCTGTTTCCA 4 |
