TABLE 2.
Primers and probes used in this study
| Reference | Primer or probe (name) | Sequence (5′→3′) | Tm(s)a (°C) | Position (bp)b | Fluorophore and quencherc | Amplicon length (bp) |
|---|---|---|---|---|---|---|
| This study | Forward primer (CVCf) | GGGCTACACACGTRCTACAATG | 59.2, 53.7 | 1220-1241 | 167 | |
| Reverse primer (CVCr) | CCGGGAACGTATTCACCG | 58 | 1386-1369 | |||
| Probe (CVC-P) | CGATTACTAGCGATTCC | 68.2 | 1353-1337 | 5′ VIC, 3′ MGBnfq | ||
| 17 | Forward primer (P891F) | TGGAGCATGTGGTTTAATTCGA | 59.1 | 943-964 | 159 | |
| Reverse primer (P1033R) | TGCGGGACTTAACCCAACA | 58.6 | 1101-1083 | |||
| Probe (UniProbe) | CACGAGCTGACGACARCCATGCA | 69.5, 67.3 | 1074-1052 | 5′ TET (original study used VIC), 3′ TAMRA | ||
| 13 | Forward primer (Nf) | TCCTACGGGAGGCAGCAGT | 59.4 | 340-358 | 467 | |
| Reverse primer (Nr) | GGACTACCAGGGTATCTAATCCTGTT | 58.1 | 806-781 | |||
| Probe (N-P) | CGTATTACCGCGGCTGCTGGCAC | 69.9 | 537-515 | 5′ 6-FAM, 3′ TAMRA |
a
Tms were calculated with Primer Express software (Applied Biosystems).
b
Numbered according to the E. coli O157:H7 rrsA gene (GenBank accession number AB035920).
c
MGBnfq, minor groove binder nonfluorescent quencher (ABI); TET, tetrachloro-6-carboxyfluorescein; 6-FAM, 6-carboxyfluorescein.