Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Characteristics of three polymorphic microsatellite markers of P. marneffei
| Microsatellite | GenBank accession no. | Microsatellite sequencea | Primer sequences (5′ to 3′) | Range of PCR (bp) | No. of alleles |
|---|---|---|---|---|---|
| I | AL684924 | (GA)7AC(GA)22 | AGTAGTTCATCGGCCGAA | 172-266 | 14 |
| GTACCCTTCAAGGTGGTA | |||||
| II | AL686035 | (CA)7TA(CA)7 | AGCTGGAACTGCACCTCTGA | 136-157 | 8 |
| CTTTTGGAGCTGGGTCTGCA | |||||
| III | AL684847 | (CA)6TA(CA)6 | CTATGCCGGGAAGGCAGTGA | 206-226 | 7 |
| ACCCTACGCACTAGACGGAA |
Based on P. marneffei strain PM1.
