Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Primer sequence used for qPCR.
| Gene | Forward primer | Reverse primer |
|---|---|---|
| Atm | cgtgggtgtgaccttcagta | actctgccactcccactgtt |
| Brca1 | gagctggagatgaaggcaag | ctgcatccagtctgtcctca |
| Parp1 | ttaatgacacctgcctgctg | actccagcgcaacctatctg |
| Prkdc | tcctagaccttcaccgatgg | gtgtgggtatgtgtgggtga |
| Rad51 | ctccagttgcatgcttgttc | agagcacaggaacgatacgg |
| Xrcc6 | gatctgacactgcccaaggt | tgcttcttcggtccactctt |
| Gapdh | gtggacctcatggcctacat | ggatggaattgtgagggaga |
