Table 1. PCR primers and PCR-RFLP tests for genotyping in the bovine TNP2 gene.

SNP	Primer sequences	AT (°C)	SAF (bp)/AR	RE	RES, bp/genotype
g.269 G>A	F: CAGAGCCTTCCCAACACCC	62	195(100–294)	HpaII	GG: 135, 33, 27
	R: GCTGGGGCCTGGGCTCTGG				GA: 135, 60, 33, 27
					AA: 135, 60
g.480 C>T	F: AGGAGCCACCGCAGCCCCACTGGGC	59	350(244–593)	HpaII	CC: 237, 113
	R: TGCCTGTGGGTCCTCTGTGC				CT: 350, 237, 113
					TT: 350
g.1536 C>T	F: ACTGGACCAATGAACGAA	54	535(1101–1635)	HindIII	CC: 535
	R: CTCCCTACCCAACCTCTT				CT: 535, 432, 103
					TT: 432, 103

Note: Underlined nucleotides mark nucleotide mismatches enabling the use of the selected restriction enzymes for discriminating sequence variations. AT annealing temperature, SAF size of amplification fragment, RE restriction enzyme, and RES size of fragments at the indicated allele after digestion of the PCR product use the respective restriction enzyme and SNP single nucleotide polymorphism.