Skip to main content
NCBI home page
Molecules and Cells logoLink to Molecules and Cells
. 2013 Aug 29;36(4):368–375. doi: 10.1007/s10059-013-0191-x

Transcription Factors Sp1 and Sp3 Regulate Expression of Human ABCG2 Gene and Chemoresistance Phenotype

Wook-Jin Yang 1,3, Min-Ji Song 1,3, Eun Young Park 2, Jong-Joo Lee 1, Joo-Hong Park 1, Keunhee Park 1, Jong Hoon Park 2, Hyoung-Pyo Kim 1,*
PMCID: PMC3887993  PMID: 23996530

Abstract

ABCG2 is a member of the ATP binding cassette (ABC) transmembrane proteins that plays an important role in stem cell biology and drug resistance of cancer cells. In this study, we investigated how expression of human ABCG2 gene is regulated in lung cancer A549 cells. Binding of Sp1 and Sp3 transcription factors to the ABCG2 promoter in vitro and in vivo was elucidated by electro-phoretic mobility shift assay and chromatin immunoprecipitation assay. The ABCG2 promoter activity was impaired when Sp1 sites were mutated but was enhanced by over-expression of Sp1 or Sp3 proteins. Knockdown of Sp1 or Sp3 expression by short interfering RNA significantly decreased the expression of ABCG2 mRNA and protein, resulting in attenuated formation of the side population in A549 cells. In addition, Sp1 inhibition in vivo by mithramycin A suppressed the percentage of the side population fraction and sphere forming activities of A549 cells. Moreover, inhibiting Sp1- or Sp3-dependent ABCG2 expression caused chemosensitization to the anticancer drug cisplatin. Collectively, our results demonstrate that Sp1 and Sp3 transcription factors are the primary determinants for activating basal transcription of the ABCG2 gene and play an important role in maintaining the side population phenotype of lung cancer cells.

Keywords: ABCG2, Sp1, Sp3, side population, transcription, chemoresistance

INTRODUCTION

ABCG2 is a member of the ATP binding cassette (ABC) transporters, which uses cellular ATP to drive the transport of various substrates including drugs, metabolites, and other compounds across cell membranes (Mo and Zhang, 2012). The human ABCG2 gene was first cloned from doxorubicin-resistant human MCF-7 breast cancer cells, and its coded protein contains 655 amino acids, including a single N-terminal ATP-binding cassette, and 6 transmembrane segments (Allikmets et al., 1998; Doyle et al., 1998; Miyake et al., 1999). ABCG2 is a half-transporter, requiring dimerization or oligomerization to become functionally active (Kage et al., 2002; Xu et al., 2007). ABCG2 is widely distributed in normal tissues and highly expressed in stem cells, and identified as a molecular determinant of the side population (SP) phenotype, which is characterized by the ability to transport the fluorescent dye Hoechst 33342 (Scharenberg et al., 2002; Zhou et al., 2001). Several previous reports suggested that ABCG2 is fundamental for the maintenance of the stem cell phenotype and plays an important role in promoting proliferation and blocking differentiation of stem cells (Bunting, 2002). ABCG2 overexpression is also frequently observed in a variety of tumor cells (Hirschmann-Jax et al., 2004), and the ABCG2+ subset of tumor cells are often enriched in cells with cancer stem-like phenotypes (Ho et al., 2007), which represent a population of drug resistant cells that can survive treatment and repopulate the tumor (Dalerba et al., 2007).

The human ABCG2 gene is transcribed by a TATA-less promoter, with several putative Sp1, AP1, and AP2 sites and a CCAAT box (Bailey-Dell et al., 2001). Both positive and negative cis-regulatory elements have been identified in the ABCG2 promoter, and functional hormone and hypoxia response elements upstream of the ABCG2 gene have been reported (Ee et al., 2004; Krishnamurthy et al., 2004; Szatmari et al., 2006). DNA methylation and histone modifications were reported to play important roles in the epigenetic regulation of ABCG2 expression in human renal carcinoma and multidrug-resistant cells, respectively (To et al., 2006; 2008; Turner et al., 2006). The ABCG2 gene is also under posttranscriptional regulation by microRNAs and carries the binding sites for microRNAs such as hsa-miR-328, −519c, and −520h in its 3′-untranslated region (Pan et al., 2009; To et al., 2009; Wang et al., 2010).

In this study, we investigated how expression of the human ABCG2 gene is regulated in lung cancer A549 cells and found that both Sp1 and Sp3 transcription factors are critical for activating basal transcription of the ABCG2 gene, and play an important role in maintaining the SP phenotype of lung cancer cells.

MATERIALS AND METHODS

Cell culture

A549 were purchased from the American Type Culture Collection and maintained in Dulbecco’s modified Eagle medium (DMEM) supplemented with 10% heat-inactivated fetal bovine serum (FBS) and 100 U/ml penicillin/streptomycin.

Electrophoretic mobility shift assays (EMSAs)

EMSAs were performed essentially as described (Lee et al., 2011). Oligonucleotide sequences from the human ABCG2 promoter used as EMSA probes are shown in Fig. 1A.

Fig. 1.

Fig. 1.

Open in a new tab

Sp1 and Sp3 factors directly bind the ABCG2 promoter. (A) Sequences of the WT1, WT2, and WT3 probes (spanning the -220/-199, -122/-89, -70/-49, respectively), and consensus Sp1/Sp3 probe (WT4) used in (Figs. 1B–1E) are shown. For mutant (mt) probes, the mutations are shown in lower case, and hyphens indicate identity to the WT sequence. (B) Electrophoretic mobility shift assay (EMSA) using wild type (WT) and mutant (mt) probes shown in Fig. 1A and nuclear extracts from A549 cells. (C–E) EMSA using WT1 (C), WT2 (D), or WT3 (E) probes and nuclear extracts from A549 cells. In lanes 2 and 3, EMSA were performed in the presence of a 125-fold molar excess of the indicated cold competitors. In lanes 4–6, EMSA were performed in the presence of antibodies to Sp1 and/or Sp3, as indicated. (F, G) Sp1 and Sp3 bind to the ABCG2 promoter in vivo. Chromatin immunoprecipitation (ChIP) assays were performed with A549 cells in the presence of pre-immune serum, anti-Sp1 (F) or anti-Sp3 antibodies (G). DNA was purified and used as a template for qRT-PCR with pairs of primers that amplify the proximal promoter (pro) or distal region of the ABCG2 gene. Data are shown as mean ± SEM of results from three experiments.

Chromatin immunoprecipitation (ChIP)

ChIP assays were performed essentially as described (Lee et al., 2011) using antibodies specific for Sp1 or Sp3 (Santa Cruz Biotechnology, Inc.). The sequences of the ABCG2 primers were as follows: ABCG2 proximal promoter, 5′-TTCAGCCGG GTCGCAGGGCGCTTAT-3′, 5′-TGGACCGCCAGAGCTGAAC GCAGTG-3′; ABCG2 distal, 5′-TTTCGTGTGTGTTTTCTCCA-3′, 5′- GCTCACCCAGATAAGTGAAAAGA-3′.

Plasmids

To generate the wild type (WT) human ABCG2 promoter luciferase reporter construct, we subcloned the ABCG2 gene −1058 to +307 region 5′ to the luciferase gene between the XhoI and HindIII sites in the polylinker of the pGL3-Basic luciferase reporter vector (Promega). Site-directed mutagenesis of the ABCG2 Sp1 sites in this plasmid was performed using the QuikChange kit (Stratagene). Three mutagenic primers, 5′-TGACCCTAGCC CCGAGGGAGTTAGGTGGTACCAGTCCTGCTGG-3′, 5′-GG CCCGGCAGTCGGGGCCACTAATCACCCCCTGTCGCGAA CCCCGACCTGGGGA-3′, and 5′-TGGGGAAACCCGGGGC GCTGAAAAGGGGCCACTGCGTTCAGCT-3′ were used to introduce the indicated underlined 3-bp changes into the Sp1 sites at −212, −119, −99, and −61, respectively. The pCMV-Sp1 and pN3-Sp3FL were purchased from Addgene. The shRNA lentiviral vectors for Sp1 and Sp3 were described previously (Lee et al., 2011).

Transient transfections and luciferase assays

The transient transfections were performed using Effectene transfection reagent (QIAGEN) according to the manufacturer’s instructions. In each case, 8 × 104 cells in logarithmic growth phase were transfected with 200 ng supercoiled test plasmid and 10 ng pRL-SV40 as a transfection efficiency control. The cells were allowed to recover for 24 h at 37°C, and harvested and analyzed for luciferase activity using a luminometer (TD-20/20 Luminometer; Turner Designs, Promega) and a dual luciferase assay system kit (Promega).

Lentiviral transduction

The 293T cells (2 × 106) were seeded onto 100-mm dishes, and 16 h later were transiently transfected with 1 μg lentiviral vector and 3 μg each packaging vector (Invitrogen Life Sciences) by using Effectene (QIAGEN). Supernatants were collected 48 h after transfection, and filtered through a 0.45 μM filter. A549 cells (2 × 105) were seeded into 24-well plates and spin-infected in the presence of 6 μg/ml of Polybrene® (Sigma-Aldrich). Twenty-four hours post-infection, cells were treated with 2 μg/ml puromycin or G418 for 5 days to eliminate uninfected cells.

Quantitative real time PCR

Total RNA was isolated using TRIzol (Invitrogen) and first-strand cDNAs were made using the PrimeScript RT Kit (Takara). Quantitative real time PCR was performed on a StepOne™ Real-Time PCR System (Applied Biosystems). The sequences of the primers were as follows: human ABCG2; 5′-ATGG ATTTACGGCTTTGCAG-3′, 5′-TCTTCGCCAGTACATGTTGC-3′; human Sp1, 5′-GCGAGAGGCCATTTATGTGT-3′, 5′-GGC CTCCCTTCTTATTCTGG-3′; human Sp3, 5′-ATTCTGGAGA ACGCCCTTTT-3′, 5′-TATGTTTGGCAAGGTGGTCA-3′; 18S rRNA, 5′-CGGCTACCACATCCAAGGAA-3′, 5′-GCTGGAATT ACCGCGGCT-3′.

Flow cytometry

ABCG2 expression was assayed by flow cytometry using an antibody that specifically recognizes membrane-bound ABCG2 epitopes (ABCG2-PE; eBioscience). SP abundance was determined as described (Goodell et al., 2005) with minor modifications. Briefly, cells (1 × 106/ml) were incubated at 37°C for 60 min with 5 μg/ml Hoechst 33342 (Sigma-Aldrich), washed, and resuspended in ice-cold HBSS with 2% fetal calf serum (FCS) and 2 μg/ml propidium iodide (Sigma-Aldrich). Fumitremorgin C (FTC; 10 μmol/L; Enzo Life Sciences), a potent and specific inhibitor of ABCG2 activity, was used as a positive control for the assay. Labeled cells were analyzed by flow cytometry on a LSRII (BD Biosciences).

Sphere-forming assay

A single cell suspension from trypsinization was cultured in serum-free DMEM/F12 medium with growth factors (10 ng/ml of EGF and bFGF) at a density of 1 × 103 cells/ml. After 10 days, spheres were attached by adding FBS (10%), stained with Diff-Quick solution (Sysmex, Japan), and counted.

MTT assay

Approximately 2.0 × 103 cells were seeded into each well of a 96-well plate. After 24 h incubation, the cells were exposed to various concentrations of cisplatin for 72 h. After incubation, 10 μl MTT was added to each well and cells were further incubated for 4 h, followed by 100 μl solubilization buffer overnight. The mixture was gently shaken for 10 min. Cell viability was evaluated based on absorbance at 550 nm in a Sunrise micro-plate absorbance reader (Tecan).

RESULTS

Sp1 and Sp3 directly bind to the ABCG2 promoter region and increase ABCG2 promoter activity

Analysis of the ABCG2 promoter region revealed several potential consensus sequences for factor binding, including four consensus Sp1 binding sites (Yuan et al., 2004). We therefore performed EMSA to evaluate binding of 32P-labeled DNA probes that spanned these Sp1 sites by proteins from A549 nuclear extracts. When WT probes spanning the Sp1 sites at −212 (WT1), −119 and −99 (WT2), and −61 (WT3) (shown in Fig. 1A) were assayed, two complexes (designated as C1 and C2) were detected with extracts from A549 cells, but the mutations of the Sp1 sites eliminated the formation of these complexes (Fig. 1B). The complexes generated with WT probes were competed by a 125-fold excess of unlabeled wild type competitors, whereas mutant Sp1 oligonucleotides were not effective at inhibiting the formation of complexes (Figs. 1C, 1D, and 1E), indicating that these complexes were specific. The complexes formed with WT probes were evaluated for Sp1 and Sp3 using antibodies to each protein. We found that anti-Sp1 blocked the formation of the C1 complex and anti-Sp3 antibodies resulted in a supershift of the C2 complex to generate a slower mobility complex, confirming the binding of Sp1 and Sp3 to these regions (Figs. 1C, 1D, and 1E). We next performed chromatin immunoprecipitation to examine whether Sp1 and Sp3 bind to the endogenous ABCG2 promoter in A549 cells in vivo. As shown in Figs. 1F and 1G, constitutive recruitment of Sp1 and Sp3 to the ABCG2 proximal promoter, but not to the distal region, was observed in A549 cells.

To evaluate the functional significance of Sp1 sites in the ABCG2 promoter region, we cloned the promoter region of the ABCG2 gene, mutated each Sp1 site alone and in combination in the context of the −1058 to +307 human ABCG2-luciferase reporter construct, and assayed the promoter activity of each mutant construct in A549 cells (Fig. 2A). Whereas the wild type construct showed strong promoter activity, selective mutation of the Sp1 sites at −212 (mt1) markedly decreased promoter activity. However, selective mutations of the Sp1 sites at −119 and −99 (mt2) or −61 (mt3) modestly decreased promoter activities, although simultaneous mutations of the three Sp1 sites (mt5) significantly decreased promoter activity. These results suggest that the Sp1 site at −212 is most critical for maximal ABCG2 promoter activity in A549 cells. To further demonstrate that the Sp family of transcription factors is involved in the transcriptional regulation of human ABCG2, we co-transfected A549 cells with a luciferase reporter construct in the presence and absence of expression plasmids encoding Sp1 and Sp3. The activity of the pABCG2-1058-WT construct was markedly increased in the presence of pCMV-Sp1 and pN3-Sp3FL, indicating that transcription factors Sp1 and Sp3 directly regulate the expression of ABCG2 (Figs. 2B and 2C).

Fig. 2.

Fig. 2.

Open in a new tab

Sp1 and Sp3 factors increase ABCG2 promoter activities. (A) Mutations in the Sp1/Sp3 sites were introduced into the pABCG2-WT construct, and luciferase (Luc) reporter constructs were transfected into A549 cells. *P < 0.05 compared with cells transfected with pABCG2- WT construct. (B, C) A549 cells were transfected with pABCG2-WT construct (100 ng) together with different amounts (0, 100, 200, and 400 ng) of Sp1 (B) or Sp3 vector (C). Data are shown as mean ± SEM of results from three experiments.

Sp1 and Sp3 are required for ABCG2 gene expression and SP phenotype

Because Sp1 and Sp3 directly bind to the ABCG2 promoter region and increase ABCG2 promoter activities in transient transfections, we investigated whether ABCG2 gene expression is dependent on Sp1 and Sp3 using a lentiviral vector and RNA interference to inhibit the expression of these genes. The expression of Sp1 or Sp3 at mRNA and protein levels were markedly decreased in A549 cells infected with lentivirus containing shRNA against Sp1 or Sp3, whereas expression of β-actin protein was unaffected (Figs. 3A–3D). Strikingly, ABCG2 mRNA and protein were significantly decreased in Sp1- or Sp3-diminished A549 cells compared to the control cells (Figs. 3A, 3B, 3E, and 3F). The SP phenotype is mainly mediated by ABCG2 in cancer cells. To investigate whether reduced ABCG2 expression affects SP formation in Sp1- or Sp3-diminished A549 cells, Hoechst 33342 dye exclusion assays were performed. The results show that control cells contain approximately 4% of the SP fraction which was completely blocked by FTC treatment, whereas the percentage of SP drops to less than 1% in Sp1- or Sp3-diminished A549 cells (Figs. 3G and 3H).

Fig. 3.

Fig. 3.

Open in a new tab

Knockdown of Sp1 or Sp3 represses ABCG2 expression and alters the SP phenotype in A549 cells. A549 cells were infected with lentivirus expressing shRNA against Sp1 (A, C, E, and G) or Sp3 (B, D, F, and H), and drug resistant cells were selected. Real-time PCR was performed to analyze mRNA levels of Sp1, Sp3, and ABCG2 expression and normalized with the 18S rRNA level (A, B). *P < 0.05 compared with control. Values are mean ± SEM of results from three experiments. Whole cell lysates were separated with SDS/PAGE and subjected to Western blotting using antibodies to Sp1, Sp3, and actin (C, D). ABCG2 expression on the cell surface was assayed by flow cytometry using an antibody that specifically recognizes membrane-bound ABCG2 epitopes (E, F). To determine SP abundance, cells were incubated with Hoechst 33342 dye in the absence (left panels of G, H) or presence (right panels of G, H) of fumitremorgin C (FTC). The SP is shown as a percentage of the whole viable cell population. Reactions were performed in triplicates and were repeated three times.

To further investigate the role of Sp1 and Sp3 transcription factors on ABCG2 gene transactivation, we treated A549 cells with mithramycin A, a drug that binds to the minor grooves of the GC-rich motifs of the DNA and hence blocks Sp1 binding. As shown in Figs. 4A and 4B, the expression of ABCG2 mRNA and protein was markedly decreased in A549 cells by treatment with mithramycin A, in a dose-dependent manner. Consistently, mithramycin A treatment suppressed the percentage of SP fraction (Fig. 4C) and sphere forming activities (Figs. 4D and 4E), suggesting an essential role of Sp1 and Sp3 transcription factors in the function of ABCG2, as well as in maintaining the stemness of A549 cells.

Fig. 4.

Fig. 4.

Open in a new tab

Mithramycin A blocks the expression of the ABCG2 gene and alters the SP phenotype and sphere-forming activities in A549 cells. (A) A549 cells were treated with different amounts of mithramycin A (0, 50, 100, and 200 nM) for 24 h. Real-time PCR was performed to analyze mRNA levels of ABCG2 expression and normalized with the 18S rRNA level. (B, C) A549 cells were treated with different amounts of mithramycin A before staining with anti-ABCG2 antibody (B) or Hoechst 33342 dye (C), and analyzed by flow cytometry. Reactions were done in triplicate and repeated three times. (D) A549 cells were treated with different amounts of mithramycin A and the sphere-forming assay was performed to analyze the maintenance of stemness in A549 cells. Representative images of spheres (D) and quantification of the assays (E). * indicates P < 0.05 and ** indicates P < 0.01 compared with controls. Values are mean ± SEM of results from three experiments.

Inhibiting Sp1- or Sp3-dependent ABCG2 expression causes chemosensitization to the anticancer drug cisplatin

To determine whether decreased expression of Sp1 or Sp3 could sensitize A549 cells to anticancer drug-induced cytotoxicity, we incubated either Sp1- or Sp3-diminished cells with cisplatin for 3 days and measured the percentage of viable cells using the MTT assay. In the absence of cisplatin, knockdown of Sp1 expression had little effect on the viability of A549 cells (Fig. 5A), while A549 cells exhibited reduction in cellular viability after knockdown of Sp3 (Fig. 5B). Interestingly, both Sp1- and Sp3-diminished A549 cells, with lower endogenous levels of ABCG2, exhibited significantly enhanced sensitivities to cisplatin compared to the control A549 cells (Figs. 5A and 5B), demonstrating that inhibiting Sp1- or Sp3-dependent ABCG2 expression causes chemosensitization to the anticancer drug cisplatin.

Fig. 5.

Fig. 5.

Open in a new tab

The role of Sp1 and Sp3 on the chemoresistance phenotype of A549 cells. Sp1-diminished (A) or Sp3-diminished (B) A549 cells were treated with cisplatin (7 mM) for 72 h and cellular viability was measured by the MTT assay. * indicates P < 0.05 and ** indicates P < 0.01 compared with controls. Values are mean ± SEM of results from three experiments.

DISCUSSION

In the present study, we show that Sp1 together with Sp3 directly regulated transcriptional expression of the ABCG2 gene, and diminished expression of Sp1 and Sp3 resulted in a dramatic decrease of SP formation and enhanced chemosensitivity to anticancer drug in a lung cancer cell line. Previous studies have shown that the ABCG2 proximal promoter region contained several putative Sp1 binding sites to which the homeobox gene Msx2 recruits Sp1 to increase ABCG2 gene expression (Hamada et al., 2012). In addition, another group has reported that increased occupancy of Sp1 within the ABCG2 promoter coincided with upregulation of ABCG2 and simultaneous mutation of five Sp1 binding sites markedly attenuated ABCG2 promoter activities (Zhang et al., 2012). Thus far, however, no definitive data that support Sp1 transcription factor as the direct regulator of the ABCG2 gene expression has been reported. Although it has been shown that mithramycin A, a known inhibitor of Sp1 binding, mediated dose-dependent decreases in ABCG2 expression, treatment with mithramycin A also resulted in decreased expression of other transcription factors such as AhR and Nrf (Zhang et al., 2012). This makes it uncertain whether Sp1 directly regulates ABCG2 gene expression.

Several results from our study support the hypothesis that Sp3 together with Sp1 are required for transactivation of the ABCG2 gene in A549 cells. Sp3, one of the Sp1-related transcription factors, is ubiquitously expressed and recognizes the same sequence as Sp1 (Safe and Abdelrahim, 2005). First, EMSA and ChIP assays showed in vitro and in vivo binding activity of Sp1 and Sp3 to ABCG2 promoter regions. Second, site-specific mutagenesis of Sp1/Sp3 binding sites significantly diminished ABCG2 promoter activity and increased expression of either Sp1 or Sp3 enhanced ABCG2 promoter activity. Third, specific knockdown of Sp1 or Sp3 using a shRNA lentivirus-based system resulted in significantly diminished ABCG2 expression at both mRNA and protein levels. Fourth, treatment with mithramycin A, an inhibitor of Sp1/Sp3 binding, significantly decreased ABCG2 expression, consistent with a previous report (Zhang et al., 2012).

The expression of the ABCG2 gene is an important determinant of the SP phenotype and the SP cells in lung cancer cell lines were an enriched source of tumor-initiating cells with stem cell properties (Ho et al., 2007). Recently, phosphoinositide-3 kinase pathway has been shown to regulate ABCG2 function in malignant pleural mesothelioma, and inhibiting the PI3K/Akt pathway strongly decreased the SP phenotype resulting in increased sensitivity to chemotherapeutic drug (Fischer et al., 2012). In line with these reports, decreased expression of ABCG2 resulting from depletion of Sp1 and Sp3 either by shRNA approaches or treatment of mithramycin A demonstrated diminished SP phenotypes. Furthermore, sphere-forming ability of A549 cells was suppressed by mithramycin A in a dose-dependent manner, suggesting that Sp1 and Sp3 play an important role in maintenance of stemness of lung cancer cell lines through regulating ABCG2 expression. Elevated expression of ABCG2 is known to contribute to multidrug resistance in cancer chemotherapy (Chen et al., 2011). Depletion of Sp1 or Sp3 and a parallel decrease in ABCG2 expression caused enhanced sensitivity to cisplatin in A549 cells.

In summary, our findings clarified the role of Sp1 and Sp3 in the regulation of the human ABCG2 gene and demonstrated that modulating the expression of ABCG2 by inhibiting Sp1 or Sp3 may be an alternative way to sensitize ABCG2-mediated drug resistance for better treatment of lung cancers.

Acknowledgments

This work was supported by a National Research Foundation of Korea (NRF) grant funded by the Korea government (Ministry of Science, Ict & future Planning; numbers 2012M3A9B402 8272 and NRF-2011-0030712), a grant from the National R&D Program for Cancer Control, Ministry for Health, Welfare and Family Affairs, Korea (1120370, H.-P. Kim), and a faculty research grant from Yonsei University College of Medicine for 2008 (6-2012-0103 to H.-P. Kim).

REFERENCES

  1. Allikmets R, Schriml LM, Hutchinson A, Romano-Spica V, Dean M. A human placenta-specific ATP-binding cassette gene (ABCP) on chromosome 4q22 that is involved in multidrug resistance. Cancer Res. 1998;58:5337–5339. [PubMed] [Google Scholar]
  2. Bailey-Dell KJ, Hassel B, Doyle LA, Ross DD. Promoter characterization and genomic organization of the human breast cancer resistance protein (ATP-binding cassette transporter G2) gene. Biochim. Biophys Acta. 2001;1520:234–241. doi: 10.1016/s0167-4781(01)00270-6. [DOI] [PubMed] [Google Scholar]
  3. Bunting KD. ABC transporters as phenotypic markers and functional regulators of stem cells. Stem Cells. 2002;20:11–20. doi: 10.1002/stem.200011. [DOI] [PubMed] [Google Scholar]
  4. Chen YJ, Huang WC, Wei YL, Hsu SC, Yuan P, Lin HY, Wistuba II, Lee JJ, Yen CJ, Su WC, et al. Elevated BCRP/ABCG2 expression confers acquired resistance to gefitinib in wild-type EGFR-expressing cells. PLoS One. 2011;6:e21428. doi: 10.1371/journal.pone.0021428. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Dalerba P, Cho RW, Clarke MF. Cancer stem cells: models and concepts. Ann Rev Med. 2007;58:267–284. doi: 10.1146/annurev.med.58.062105.204854. [DOI] [PubMed] [Google Scholar]
  6. Doyle LA, Yang W, Abruzzo LV, Krogmann T, Gao Y, Rishi AK, Ross DD. A multidrug resistance transporter from human MCF-7 breast cancer cells. Proc. Natl. Acad. Sci USA. 1998;95:15665–15670. doi: 10.1073/pnas.95.26.15665. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Ee PL, Kamalakaran S, Tonetti D, He X, Ross DD, Beck WT. Identification of a novel estrogen response element in the breast cancer resistance protein (ABCG2) gene. Cancer Res. 2004;64:1247–1251. doi: 10.1158/0008-5472.can-03-3583. [DOI] [PubMed] [Google Scholar]
  8. Fischer B, Frei C, Moura U, Stahel R, Felley-Bosco E. Inhibition of phosphoinositide-3 kinase pathway down regulates ABCG2 function and sensitizes malignant pleural mesothelioma to chemotherapy. Lung Cancer. 2012;78:23–29. doi: 10.1016/j.lungcan.2012.07.005. [DOI] [PubMed] [Google Scholar]
  9. Goodell MA, McKinney-Freeman S, Camargo FD. Isolation and characterization of side population cells. Methods Mol Biol. 2005;290:343–352. doi: 10.1385/1-59259-838-2:343. [DOI] [PubMed] [Google Scholar]
  10. Hamada S, Satoh K, Hirota M, Kanno A, Umino J, Ito H, Masamune A, Kikuta K, Kume K, Shimosegawa T. The homeobox gene MSX2 determines chemosensitivity of pancreatic cancer cells via the regulation of transporter gene ABCG2. J Cell Physiol. 2012;227:729–738. doi: 10.1002/jcp.22781. [DOI] [PubMed] [Google Scholar]
  11. Hirschmann-Jax C, Foster AE, Wulf GG, Nuchtern JG, Jax TW, Gobel U, Goodell MA, Brenner MK. A distinct “side population” of cells with high drug efflux capacity in human tumor cells. Proc. Natl. Acad. Sci USA. 2004;101:14228–14233. doi: 10.1073/pnas.0400067101. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Ho MM, Ng AV, Lam S, Hung JY. Side population in human lung cancer cell lines and tumors is enriched with stem-like cancer cells. Cancer Res. 2007;67:4827–4833. doi: 10.1158/0008-5472.CAN-06-3557. [DOI] [PubMed] [Google Scholar]
  13. Kage K, Tsukahara S, Sugiyama T, Asada S, Ishikawa E, Tsuruo T, Sugimoto Y. Dominant-negative inhibition of breast cancer resistance protein as drug efflux pump through the inhibition of S-S dependent homodimerization. Int. J Cancer. 2002;97:626–630. doi: 10.1002/ijc.10100. [DOI] [PubMed] [Google Scholar]
  14. Krishnamurthy P, Ross DD, Nakanishi T, Bailey-Dell K, Zhou S, Mercer KE, Sarkadi B, Sorrentino BP, Schuetz JD. The stem cell marker Bcrp/ABCG2 enhances hypoxic cell survival through interactions with heme. J Biol Chem. 2004;279:24218–24225. doi: 10.1074/jbc.M313599200. [DOI] [PubMed] [Google Scholar]
  15. Lee JJ, Park K, Shin MH, Yang WJ, Song MJ, Park JH, Yong TS, Kim EK, Kim HP. Accessible chromatin structure permits factors Sp1 and Sp3 to regulate human TGFBI gene expression. Biochem Biophys Res Commun. 2011;409:222–228. doi: 10.1016/j.bbrc.2011.04.127. [DOI] [PubMed] [Google Scholar]
  16. Miyake K, Mickley L, Litman T, Zhan Z, Robey R, Cristensen B, Brangi M, Greenberger L, Dean M, Fojo T, et al. Molecular cloning of cDNAs which are highly overexpressed in mitoxantrone-resistant cells: demonstration of homology to ABC transport genes. Cancer Res. 1999;59:8–13. [PubMed] [Google Scholar]
  17. Mo W, Zhang JT. Human ABCG2: structure, function, and its role in multidrug resistance. Int J Biochem Mol Biol. 2012;3:1–27. [PMC free article] [PubMed] [Google Scholar]
  18. Pan YZ, Morris ME, Yu AM. MicroRNA-328 negatively regulates the expression of breast cancer resistance protein (BCRP/ABCG2) in human cancer cells. Mol Pharmacol. 2009;75:1374–1379. doi: 10.1124/mol.108.054163. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Safe S, Abdelrahim M. Sp transcription factor family and its role in cancer. Eur. J Cancer. 2005;41:2438–2448. doi: 10.1016/j.ejca.2005.08.006. [DOI] [PubMed] [Google Scholar]
  20. Scharenberg CW, Harkey MA, Torok-Storb B. The ABCG2 transporter is an efficient Hoechst 33342 efflux pump and is preferentially expressed by immature human hematopoietic progenitors. Blood. 2002;99:507–512. doi: 10.1182/blood.v99.2.507. [DOI] [PubMed] [Google Scholar]
  21. Szatmari I, Vamosi G, Brazda P, Balint BL, Benko S, Szeles L, Jeney V, Ozvegy-Laczka C, Szanto A, Barta E, et al. Peroxisome proliferator-activated receptor gamma-regulated ABCG2 expression confers cytoprotection to human dendritic cells. J Biol Chem. 2006;281:23812–23823. doi: 10.1074/jbc.M604890200. [DOI] [PubMed] [Google Scholar]
  22. To KK, Zhan Z, Bates SE. Aberrant promoter methylation of the ABCG2 gene in renal carcinoma. Mol Cell Biol. 2006;26:8572–8585. doi: 10.1128/MCB.00650-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. To KK, Polgar O, Huff LM, Morisaki K, Bates SE. Histone modifications at the ABCG2 promoter following treatment with histone deacetylase inhibitor mirror those in multidrug-resistant cells. Mol Cancer Res. 2008;6:151–164. doi: 10.1158/1541-7786.MCR-07-0175. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. To KK, Robey RW, Knutsen T, Zhan Z, Ried T, Bates SE. Escape from hsa-miR-519c enables drug-resistant cells to maintain high expression of ABCG2. Mol Cancer Ther. 2009;8:2959–2968. doi: 10.1158/1535-7163.MCT-09-0292. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Turner JG, Gump JL, Zhang C, Cook JM, Marchion D, Hazlehurst L, Munster P, Schell MJ, Dalton WS, Sullivan DM. ABCG2 expression, function, and promoter methylation in human multiple myeloma. Blood. 2006;108:3881–3889. doi: 10.1182/blood-2005-10-009084. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Wang F, Xue X, Wei J, An Y, Yao J, Cai H, Wu J, Dai C, Qian Z, Xu Z, et al. hsa-miR-520h downregulates ABCG2 in pancreatic cancer cells to inhibit migration, invasion, and side populations. Br. J Cancer. 2010;103:567–574. doi: 10.1038/sj.bjc.6605724. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Xu J, Peng H, Chen Q, Liu Y, Dong Z, Zhang JT. Oligomerization domain of the multidrug resistance-associated transporter ABCG2 and its dominant inhibitory activity. Cancer Res. 2007;67:4373–4381. doi: 10.1158/0008-5472.CAN-06-3169. [DOI] [PubMed] [Google Scholar]
  28. Yuan C, Yang MC, Zins EJ, Boehlke CS, Huang AJ. Identification of the promoter region of the human betaIGH3 gene. Mol Vision. 2004;10:351–360. [PubMed] [Google Scholar]
  29. Zhang M, Mathur A, Zhang Y, Xi S, Atay S, Hong JA, Datrice N, Upham T, Kemp CD, Ripley RT, et al. Mithramycin represses basal and cigarette smoke-induced expression of ABCG2 and inhibits stem cell signaling in lung and esophageal cancer cells. Cancer Res. 2012;72:4178–4192. doi: 10.1158/0008-5472.CAN-11-3983. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Zhou S, Schuetz JD, Bunting KD, Colapietro AM, Sampath J, Morris JJ, Lagutina I, Grosveld GC, Osawa M, Nakauchi H, et al. The ABC transporter Bcrp1/ABCG2 is expressed in a wide variety of stem cells and is a molecular determinant of the side-population phenotype. Nat Med. 2001;7:1028–1034. doi: 10.1038/nm0901-1028. [DOI] [PubMed] [Google Scholar]

Articles from Molecules and Cells are provided here courtesy of Korean Society for Molecular and Cellular Biology

RESOURCES