Table 1.
DNA and bacterial strains described in this work
| Plasmid, oligonucleotide, or strain | Description | Reference |
|---|---|---|
| Plasmids and cosmids | ||
| pMD31 | Episomal; Kanr oriE oriM | 40 |
| pMDespACD | Episomal; M. tuberculosis espACD Kanr oriE oriM | 10 |
| Oligonucleotidesa | ||
| F5R (sense) | TGAGCAGAGCGCGCATCATCGATCC | This study |
| K41A (sense) | AGTACTTCGAAGCAGCCCTGGAGGA | This study |
| F50R (sense) | TGGCAGCAGCGCGTCCGGGTGATGG | This study |
| W55R (sense) | CGGGTGATGGCCGGTTAGGTTCGGC | This study |
| G57R (sense) | ATGGCTGGTTACGTTCGGCCGCGGA | This study |
| K62A (sense) | CGGCCGCGGACGCATACGCCGGCAA | This study |
| Strains and genotypes | ||
| M. tuberculosis H37Rv | Wild type | 41 |
| M. tuberculosis H37Rv ΔRD1 | Unmarked deletion of eccCb1 to espK in esx-1 locus | 42 |
| M. tuberculosis Erdman | Wild type | 10 |
| M. tuberculosis Erdman espA::Tn | Transposon insertion in espA | 10 |
| M. tuberculosis Erdman 5′ Tn::pe35 (strain 36-72) | Transposon insertion 102 bp upstream of pe35 in esx-1 locus | 10 |
| M. tuberculosis Erdman ΔpstA1 | Unmarked in-frame deletion of pstA1 | 37 |
| espA::Tn+pMDespACD | espA::Tn fully complemented | 10 |
| espA::Tn+pMDespAF5RCD | espA::Tn complemented, expressing EspAF5R | This study |
| espA::Tn+pMDespAI23RCD | espA::Tn complemented, expressing EspAI23R | This study |
| espA::Tn+pMDespAK41ACD | espA::Tn complemented, expressing EspAK41A | This study |
| espA::Tn+pMDespAF50RCD | espA::Tn complemented, expressing EspAF50R | This study |
| espA::Tn+pMDespAW55RCD | espA::Tn complemented, expressing EspAW55R | This study |
| espA::Tn+pMDespAG57RCD | espA::Tn complemented, expressing EspAG57R | This study |
| espA::Tn+pMDespAK62ACD | espA::Tn complemented, expressing EspAK62A | This study |
a
Altered codons are underlined.