Table 1. Bacterial strains, plasmids, and oligonucleotides used in this study.

Strains, plasmids	Relevant characteristics	Reference
Strains
E. coli DH5α	supE44, ΔlacU169 (φ80lacZDM15), hsdR17, recA1, endA1, gyrA96,thi1,relA1.	Invitrogen
C. glutamicum ATCC13032	Biotin-auxotrophic wild type.	[48]
ΔaceE	C. glutamicum wild type with deletion of the aceE gene, coding for the E1p subunit of the pyruvate dehydrogenase-complex (PDHC).	[49]
ΔaceE Δpqo	C. glutamicum ΔaceE strain with deletion of the pqo gene, coding for pyruvate:quinone oxidoreductase.	[50]
ΔaceE Δpqo Δpgi	C. glutamicum ΔaceE Δpqo strain with deletion of the pgi gene, coding for the phosphoglucose isomerase.	[28]
ΔaceE Δpqo Δpgi Δpyc	C. glutamicum ΔaceE Δpqo Δpgi strain with deletion of the pyc gene, coding for the pyruvate carboxylase.	[28]
C. glutamicum sensor strain	C. glutamicum wild type strain with chromosomally integrated Lrp-sensor (integrated into the intergenic region of cg1121-cg1122) and pJC4-ilvBNCE-crimson plasmid.	This work.
ΔaceE sensor strain	ΔaceE strain with chromosomally integrated Lrp-sensor (cg1121-cg1122) and pJC4-ilvBNCE-crimson plasmid.	This work.
ΔaceE Δpqo sensor strain	ΔaceE Δpqo strain with chromosomally integrated Lrp-sensor (cg1121-cg1122) and pJC4-ilvBNCE-crimson plasmid.	This work.
ΔaceE Δpqo Δpgi sensor strain	ΔaceE Δpqo Δpgi strain chromosomally integrated Lrp-sensor (cg1121-cg1122) and pJC4-ilvBNCE-crimson plasmid.	This work.
ΔaceE Δpqo Δpgi Δpyc sensor strain	ΔaceE Δpqo Δpgi Δpyc strain with chromosomally integrated Lrp-sensor (cg1121-cg1122) and pJC4-ilvBNCE-crimson plasmid.	This work.
Plasmids
pJC1	E. coli-C. glutamicum shuttle vector, KanR, oriVEc, oriVCg.	[51]
pJC1-lrp-brnF'-eyfp	pJC1derivative containing Lrp-sensor cassette, which consists of lrp (cg0313), the intergenic region of lrp brnF (cg0314) and a transcriptional fusion of brnF with eyfp.	[22]
pJC4-ilvBNCE	pJC1derivative carrying the ilvBNCE genes coding for the L-valine biosynthetic enzymes acetohydroxyacid synthase, isomeroreductase, and transaminase B.	[25]
pJC4-ilvBNCE-crimson	pJC4-ilvBNCE derivative containing e2-crimson under transcriptional control of Ptac.	This work.
pK18-mobsacB	Vector for allelic exchange in C. glutamicum; KanR; oriVEc, sacB, lacZα.	[52]
pK18-mobsacB-cg1121, cg1122-Lrp-sensor	pK18mobsacB derivative for genomic integration of the Lrp-sensor in the intergenic region of cg1121-cg1122 in C. glutamicum.	This work.
Oligonucleotides	Sequence (5′ → 3′)
lacI-fw	TCAAGCCTTCGTCACTGGTCC	This work.
E2-Crimson-rv	CTACTGGAACAGGTGGTGGCG	This work.
Int-cg1121-fw	TTGGCGTGTGGTTGGTTAG	This work.
Int-cg1122-rv	CGCATCAAGCAGATCTCTG	This work.