Skip to main content
. 2014 Jan 22;9(1):e86763. doi: 10.1371/journal.pone.0086763

Table 2. List of primers used in this study.

Primer Sequence (5′→3′) Purpose
BT2781 GCCCGCACAAGCGGTGGAG Forward primer for 16S ribosomal gene
BT2782 ACGTCATCCCCACCTTCCT Reverse primer for 16S ribosomal gene
BT3210 CGAGGTAGATCGGCAATT Reverse primer for full-length iscR
BT3577 CCTGCTGTCGGGTAACGC Reverse primer for primer extension
BT3578 ATCATGCGCGAGGACTCC Forward primer for iscR deletion
BT3579 GGATCGGCGTTGACCAGC Reverse primer for iscR deletion
BT3555 CGCAATGGCATCGAGATCGA Forward primer for fdx2 expression
BT3556 GATAGCCGCGAATCGGGCTC Reverse primer for fdx2 expression
BT3584 CACCTGTGGGCCGACCTCAGT Site-directed mutagenesis of IscR-C111A
BT3585 CTGAGGTCGGCCCACAGGTGG Site-directed mutagenesis of IscR-C111A
BT3612 GAAGATTTCGCCGGAGTCAA Forward primer for iscR promoter fragment
BT3613 GCGTTCGGAGATATCGGCCAG Reverse primer for iscR expressionand iscR promoter fragment
EBI102 GCGACCCGCGCCCAGGGGCAG Site-directed mutagenesis of IscR-C92A
EBI103 CTGCCCCTGGGCGCGGGTCGC Site-directed mutagenesis of IscR-C92A
EBI120 ACCCCGAATGATCCCGATG Forward primer for iscR expression
EBI121 GGAAAAGCCCATGCGTCTGA Forward primer for full-length iscR
EBI142 CAGGGCGATGCCCACTCCGGC Site-directed mutagenesis of IscR-C98A
EBI143 GCCGGAGTGGGCATCGCCCTG Site-directed mutagenesis of IscR-C98A
EBI144 GGCGATACCGCTCTGACCCAC Site-directed mutagenesis of IscR-C104A
EBI145 GTGGGTCAGAGCGGTATCGCC Site-directed mutagenesis of IscR-C104A
EBI148 TCCTATCTCGCACAGCTGTTC Site-directed mutagenesis of IscR-E43A
EBI149 GAACAGCTGTGCGAGATAGGA Site-directed mutagenesis of IscR-E43A
EBI192 TGTCTGACCGCCCACCTGTGG Site-directed mutagenesis of IscR-H107A
EBI193 CCACAGGTGGGCGGTCAGACA Site-directed mutagenesis of IscR-H107A
M13F GTAAAACGACGGCCAGT Universal forward primer for expression vector
M13R AAACAGCTATGACCATG Universal reverse primer for expression vector