Figure 12. Atomic models proposed for the L-hammerhead ribozyme and the L-DNAzyme interacting with their target D-RNA.

A. L-HHRz 5′-U₁GGCGCUGAUGAGGCCGAAAGGCCGAAACUUGA₃₃-3′ (shown in blue) with D-RNA target nucleotide sequence 5′-C₁UUCAAGUCCGCCA₁₄-3′ (shown in red) with the cleavage site at nucleotide C9 (shown in green). B. L-DNAzyme 5′-G₁GCGGAGGCTAGCTACAACGATTGAAG₂₇-3′ (shown in blue) with same D-RNA target nucleotide sequence 5′-C₁UUCAAGUCCGCCA₁₄-3′ (shown in red) with the cleavage site at nucleotide G7 (shown in green). See text for detailed discussions of the models.