Table 1a.
Top three isomirs of EBV-BHRF miRNA from mature miRbase annotated sequence.
| EBV-miRNA | Match typea | Read sequence | C666 readb,d | X666 readb,d | C666 rankc,d | X666 rankc,d |
|---|---|---|---|---|---|---|
| mir-BHRF1-1-5p | **Mature 5′ | TAACCTGATCAGCCCCGGAGTT | 3 | 8 | 1st | 1st |
| Mature 5′ sub | AACCTGATCAGCCCCGGAGTT | 2 | N/A | 2nd | N/A | |
| mir-BHRF1-2-3p | Mature 3′ sub | TATCTTTTGCGGCAGAAATTG | N/A | 2 | N/A | 1st |
| **Mature 3′ | TATCTTTTGCGGCAGAAATTGA | N/A | 1 | N/A | 2nd | |
| mir-BHRF1-2-5p | Mature 5′ sub | AAATTCTGTTGCAGCAGATAG | N/A | 1 | N/A | 1st |
a
Mature 3′/5′: **Mature miRbase annotated sequence; Mature 3′/5′ sub: observed tag is shorter than reference sequence; Mature 3′/5′ super: observed tag is longer than the annotated mature sequence; Mature 3′/5′ sub/super variant: observed tag with mismatches to annotated sequence.
b
Number of reads detected in NGS. N/A: no read detected in this sample. Total read counts of EBV miRNA of C666: 1761771; X666: 469388.
c
Rank in N/A: ranking of the read in that sample is out of top3. d No mature sequence nor isomirs of mir-BART15-5p found in C666-1 and X666 NGS read.