Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
| Lib2 Forward |
TAGCCCCTCGAGGGCCAGT | RNAi insert specific: for amplifying RNAi inserts from genomic DNA |
| Lib2 Reverse |
GGAATTCGATATCAAGCTTGGC | |
| M13 Forward |
GTAAAACGACGGCCAGTG | pGEM-T-Easy vector specific: for amplifying or sequencing RNAi inserts ligated into pGEM-T-Easy |
| M13 Reverse |
GGAAACAGCTATGACCATG |
Primer sequences used in PCR reactions.
