TABLE 1.
MERS-CoV rRT-PCR assay primer/probe sequences
| Assay signature | Assay use | Genome target | Genome location | Primer or probea | Sequence (5′ to 3′) | 50× working concentration (μM) |
|---|---|---|---|---|---|---|
| upEb | Specimen screening | Noncoding region upstream of envelope gene | 27458–27475c | Forward primer | GCAACGCGCGATTCAGTT | 12.5 |
| 27549–27530c | Reverse primer | GCCTCTACACGGGACCCATA | 25 | |||
| 27477–27502c | Probe | CTCTTCACATAATCGCCCCGAGCTCG | 5 | |||
| N2 | Specimen screening | Nucleocapsid gene | 29424–29442c | Forward primer | GGCACTGAGGACCCACGTT | 12.5 |
| 29498–29477c | Reverse primer | TTGCGACATACCCATAAAAGCA | 12.5 | |||
| 29445–29471c | Probe | CCCCAAATTGCTGAGCTTGCTCCTACA | 5 | |||
| N3 | Specimen confirmation | Nucleocapsid gene | 28748–28771c | Forward primer | GGGTGTACCTCTTAATGCCAATTC | 25 |
| 28814–28795c | Reverse primer | TCTGTCCTGTCTCCGCCAAT | 25 | |||
| 28773–28793c | Probe | ACCCCTGCGCAAAATGCTGGG | 5 | |||
| RP | Sample quality control | Human RNAse P gene | 50–68d | Forward primer | AGATTTGGACCTGCGAGCG | 40 |
| 114–95d | Reverse primer | GAGCGGCTGTCTCCACAAGT | 40 | |||
| 71–93d | Probe | TTCTGACCTGAAGGCTCTGCGCG | 10 |
Probes were labeled at the 5′ end with the reporter molecule 6-carboxyfluorescein (6-FAM) and at the 3′ end with Black Hole Quencher 1 (BHQ1) (Biosearch Technologies Inc., Novato, CA).
Primer/probe sequences from a report by Corman et al. (4).
Nucleotide numbering was based on human betacoronavirus 2c EMC/2012 strain (GenBank accession number JX869059.2).
Nucleotide numbering was based on human RNase P (RP) mRNA (GenBank accession number NM_006413.4).