Skip to main content
. 2014 Feb 5;9(2):e81817. doi: 10.1371/journal.pone.0081817

Table 2. Primers used in this study with their sequences, annealing temperature and functions.

Primer Sequence 5′ — 3′ TA °C Function
SacBF2 ATGAACATCAAAAAGTTTGCAAAA 58 Amplification of sacB gene in merodiploids and to confirm the elimination of suicidal plasmid backbone in V. cholerae
SacBR TTATTTGTTAACTGTTAATTGTCC 58 Amplification of sacB gene
KanFse-2F AGCGGCCGGCCGCTTACATGGCGATAGCTA 56 Amplification of aphA cassette in V. cholerae
KanFse-R ATAGGCCGGCCTCAGAAGAACTCGTCAAGA 60 Amplification of aphA
RtxC F TTATCAGAGATGGCAGCACC 66 Amplification of rtx, ΔrtxC/A and rtx::aphA genes in V. cholerae
RtxC R CTTGTCCACCGCTGTAGCCT 66 Amplification of rtx, ΔrtxC/A and rtx::aphA genes in V. cholerae
VHAF ATGTCTTTGCTTGCCATTGG 56 Amplification of hemA and ΔhemA genes in V. cholerae
VHAR2 GTTCAGATCGTCAAGACCTA 56 Amplification of hemA and ΔhemA

TA annealing temperature.