Table 2. Primers used in this study with their sequences, annealing temperature and functions.
Primer | Sequence 5′ — 3′ | TA °C | Function |
SacBF2 | ATGAACATCAAAAAGTTTGCAAAA | 58 | Amplification of sacB gene in merodiploids and to confirm the elimination of suicidal plasmid backbone in V. cholerae |
SacBR | TTATTTGTTAACTGTTAATTGTCC | 58 | Amplification of sacB gene |
KanFse-2F | AGCGGCCGGCCGCTTACATGGCGATAGCTA | 56 | Amplification of aphA cassette in V. cholerae |
KanFse-R | ATAGGCCGGCCTCAGAAGAACTCGTCAAGA | 60 | Amplification of aphA |
RtxC F | TTATCAGAGATGGCAGCACC | 66 | Amplification of rtx, ΔrtxC/A and rtx::aphA genes in V. cholerae |
RtxC R | CTTGTCCACCGCTGTAGCCT | 66 | Amplification of rtx, ΔrtxC/A and rtx::aphA genes in V. cholerae |
VHAF | ATGTCTTTGCTTGCCATTGG | 56 | Amplification of hemA and ΔhemA genes in V. cholerae |
VHAR2 | GTTCAGATCGTCAAGACCTA | 56 | Amplification of hemA and ΔhemA |
TA annealing temperature.