Fig. 1.

High-K intake increases miR-194 transcription and decreases intersectin 1 (ITSN1) expression. A: Northern blot shows the effect of dietary K intake on the mature form of miR-194 and U6 in the mouse kidney. The sequence of oligo probe (mmu-miR-194) used for the Northern blot was TCCACATGGAGTTGCTGTTACA and probe sequence of U6 was ATATGGAACGCTTCACGAATT. The probes were labeled with [γ-³²P]. The RNA isolated from the kidney was hybridized with the probe, and the miR-194 was detected by X-ray film. Mice were kept on low-K (<0.001%), control (1% K), or high-K (5%) diets for 7 days. B: bar graph summarizes results of real-time PCR experiments showing the relative expression of pre-miR-194 in the isolated connecting tubule (CNT) and cortical collecting duct (CCD) of mice on low-K, control, or high-K diet for 7 days. C: Western blot shows the effect of dietary K intake on the expression of ITSN1 in the mouse cortex tissue. A bar graph summarizes results showing normalized changes in ITSN1 expression (bottom).