Table 1.

Quantitative PCR primers developed and used in this study.

Target OTU	Primer name	Primer sequence (5′ → 3′)	TM (°C)a	qPCR standardb	Amplicon length	Amp. Eff.c	Detect. limitd	RDP hitse
1	Alc-411	CSKTGGAGTACTTGACGT	58	HEX19	195	1.82	5	21
	Alc-604r	CTGCACTCTAGCYTGCCA						448(6)
4	Met-126f	GGGATCTGCCTGACAGTGGG	60	HEX76	90	1.63	1	88
	Met-214r	GGTTCATCTGTCAGCGTGAG						96(83)

^aEmpirically determined PCR annealing temperature.

^bRepresentative clone sequences used to generate standard curves. Names are as in Figures 3, 5.

^cAmp. Eff., amplification efficiency (Pfaffl, 2001) with OTU-specific primers.

^dDetection limit of each qPCR assay expressed as number of 16S rRNA gene copies per milliliter of culture.

^eNumber of sequences returned by the Ribosomal Database Project II release 10.18 (Cole et al., 2009)(excluding sequences from this study) with no mismatches to primer pairs. Values in parentheses are the total hits that each pair of primers target.