Table 1.
Properties of newly identified miRNA in coffee.
| Properties | Value |
|---|---|
| EST ID | Gi|315791179|gb| GW432396.1| GW432396 |
| Length of EST sequences | 554 nt |
| Precursor coordinates | 88–259 |
| Precursor length | 172 nt |
| Mature miRNA length | 22 nt |
| Mature miRNA sequence | TCCAAAGGGATCGCATTGATCC |
| MFE | −60.93 kcal/mol |
| AMFE | 35.3056 |
| MFEI | 0.88 |
| Nucleotide mismatch | 02 |
| Number of nucleotides in pre-miRNA sequences | A = 50; T/U = 59; G = 34; C = 35 |
| (A + T/U)% | 59.88 |
| (G + C)% | 40.12 |
| Family of miRNA | miR 393 |
Note: MFE, minimal folding free energy; AMFE, adjusted minimal folding free energy; MFEI, minimal folding free energy index.