Table 1. The most abundant serum mature microRNAs in DICER1-mutated PPB.
| MicroRNA and miRBase accession number | 5′–3′ nucleotide sequence | Chromosomal location(s) | PPB fold change | ‘Other tumor' fold change | Implication in NSCLC | Publication |
|---|---|---|---|---|---|---|
| miR-125a-3p (MIMAT0004602) | ACAGGUGAGGUUCUUGGGAGCC | 19q13.41 | 40.28 | 1.19 | Tissue levels correlate with stage and metastases | Jiang et al.17 |
| miR-125b-2-3p (MIMAT0004603) | UCACAAGUCAGGCUCUUGGGAC | 21q21.1 | 14.84 | 0.71 | High serum levels correlate with poor prognosis | Yuxia et al.21 |
| miR-380-5p (MIMAT0000734) | UGGUUGACCAUAGAACAUGCGC | 14q32.31 | 9.26 | 0.30 | N/A | N/A |
| miR-125b-1-3p (MIMAT0004592) | ACGGGUUAGGCUCUUGGGAGCU | 11q24.1 | 6.41 | 0.66 | High serum levels correlate with poor prognosis | Yuxia et al.21 |
| let-7f-2-3p (MIMAT0004487) | CUAUACAGUCUACUGUCUUUCC | Xp11.22 | 5.92 | 0.96 | Tissue levels correlate with reduced survival | Takamizawa et al.19 |
| let-7a-3p (MIMAT0004481) | CUAUACAAUCUACUGUCUUUC | 9q22.32; 22q13.31 | 5.87 | 1.11 | Tissue levels correlate with shortened survival | Takamizawa et al.19 |
| let-7b-3p (MIMAT0004482) | CUAUACAACCUACUGCCUUCCC | 22q13.31 | 4.57 | 1.23 | Tissue levels correlate with worse survival | Jusofovic et al.18 |
| miR-708-3p (MIMAT0004927) | CAACUAGACUGUGAGCUUCUAG | 11q14.1 | 4.15 | 0.78 | Tissue levels correlate with increased risk of death | Jang et al.16 |
| miR-138-1-3p (MIMAT0004607) | GCUACUUCACAACACCAGGGCC | 3p21.32 | 3.95 | 0.56 | Role in cisplatin resistance | Wang et al.20 |
| miR-532-3p (MIMAT0004780) | CCUCCCACACCCAAGGCUUGCA | Xp11.23 | 3.43 | 1.58 | N/A | N/A |
Abbreviations: N/A, not available; NSCLC, non-small-cell lung cancer; PPB, pleuropulmonary blastoma.
The table lists the 10 microRNAs that were most abundant in the serum in the DICER1-mutated PPB case at the time of diagnosis compared with the control group and the other childhood tumors (‘other tumors') group. It also provides information on sequence, chromosomal location and fold change in the PPB case and ‘other tumor' samples referenced to the normal control samples. Further information is provided for the microRNAs that have been implicated in adult lung malignancy.