Table 1. List of primer pairs and starting positions within the selected markers used in the present study.
| Locus | Primer name | Sequences (5′-3′) | Position (bp) | Reference |
| COI | LCO1490 | ggtcaacaaatcataaagatattgg | 23 | [29] |
| LepF1 | attcaaccaatcataaagatattgg | 23 | [17] | |
| CamF1 | ctcractaaccataargatattgg | 26 | present study | |
| ProtF2 | acgaaccatagggatatcgg | 28 | present study | |
| CamR1 | taaacttcdggrtgdccaaaaaatc | 707 | present study | |
| ProtR2 | gagcycatcatatrtttac | 863 | present study | |
| DiplR1 | gcaataattatdgtdgctgc | 919 | present study | |
| 28S rDNA | D1a | cccgcgtaatttaagcatat | 64 | [24] |
| D2a | gatagcgaacaagtacc | 416 | [24] | |
| D2aprot | gtaccgcgagggaaagttg | 428 | present study | |
| D3bint363* | gagcaccgccgaactgtg | 545 | present study | |
| D3a | gacccgtcttgaaacacgga | 950 | [24] | |
| D3arev* | tccgtgtttcaagacgggac | 1092 | [24] | |
| D3arev_prot* | ctccttggtccgtgtttc | 1102 | present study | |
| D3b | tccggaaggaaccagctacta | 1435 | [24] |
Reference sequence Sinentomon erythranum (NCBI accession number: NC015982), * indicates internal primers additionally used in some specimens.