Figure 3.

Example of a ChIP assay. H3K27me3 ChIP was performed in the wild-type and in a PRC2 complex mutant (clf-2; genetic control). 10-day-old plants were grown on 1/2 MS medium in long-day condition. H3K27me3 antibody (5 µL; AbCam) was used. ChIP DNA was amplified by real-time PCR using either a pair of primers to the second intron of a known PRC2 target gene, AGAMOUS intron 2 (AGi2; AGi2-FW: CGTTGTGATGTTACTCGGACA; AGi2-FW: CAACAACCCATTAACACATTGG) or to the promoter of the ACTIN2 (ACT2) housekeeping gene (Table 1, Wu et al., 2012). Mean ± s.e.m of three technical replicates from one representative biological replicate are shown. At least 3 biological replicates were performed.