Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Primers for ChIP assay
| Primer namea (orientation) | Sequence |
|---|---|
| −404∼−384 (sense) | TTGGATCTGAGGGTAGTGGGT |
| −213∼−193 (antisense) | GTGCCCATTAGGAAGATAGGA |
| −194∼−173 (sense) | ACAATTCTGGTACTACTGGGTT |
| +20∼+37 (antisense) | GTTTCTAACTCTGCCCCG |
Nucleotide +1 represents the site of transcription initiation of the COX-1 promoter.
