Table 3.
Splice acceptor site prediction scores for NPHP4 c.992 + 71G>T mutation versus wild type.
| Allele | Wild type aggtcatttgtgcatgtcaggtgt | c.992 + 71G>T intronEXON aggtcatttgttcatgtcagGTGT |
|---|---|---|
| NNSPLICE | 0 | 0.71 |
| ESEfinder | ||
| 3SS_U2_human (threshold: 6.632) | 0 | 7.735500 |
| 3SS_U2_mouse (threshold: 6.724) | 0 | 7.26420 |
| BranchSite (threshold: 0) | 0 | 2.07090 (tgttcat) |
| NetGene2 | 0 | 0.28 |
Sequence variants are highlighted in bold; potential splice acceptor site are underlined; predicted exonic sequence is in capital letters. 3SS_U2_Human: 3's splice sites (acceptor) of human (U2 type). 3SS_U2_mouse: 3's splice sites (acceptor) of mouse (U2 type). Branch site: mammalian branch site (U2 type). NPHP4 Genbank accession number: NG_011724.2.