Skip to main content
. 2013 Oct 24;8(4):894–907. doi: 10.1038/ismej.2013.194

Table 3. List of primers used.

Primer Sequence Description
ColE1_F 5′AGGATCCCCGGGGATAACGCAGGAAAGAACAT3′ Primer used during PCR amplification of ColE1 ori. Primer is flanked with SmaI site at 5′ end.
ColE1_R 5′GATTACGAATTCCTGTCAGACCAAGTTTACTC3′ Primer used during PCR amplification of ColE1 ori. Primer is flanked with EcoRI site at 5′ end.
Tn7R 5′CAGCATAACTGGACTGATTTCAG3′ Common primer used for checking chromosomal insertion of Tn7.
PAglmS-down 5′GCACATCGGCGACGTGCTCTC3′ Primer used with Tn7R to check chromosomal insertion of Tn7 in PAO1.
PF_tn7_R2 5′TGCCGCACATCCACGACATCCTC3′ Primer used with Tn7R to check chromosomal insertion of Tn7 in Pf-5.
KP_tn7_R2 5′GTGGCGCCGAACAACGAACTGCT3′ Primer used with Tn7R to check chromosomal insertion of Tn7 in KP-1.