. 2013 Dec 25;42(6):3954–3970. doi: 10.1093/nar/gkt1346

Table 1.

RNAs tested for Puf3p-mediated regulation of mRNA decay

mRNA^a	Mitochondrial protein function^b	(C/U)(A/C/U)UGUA(A/U)AUA binding elements located within 300-nt downstream of stop codon^c	Ratio^e of T1/2 puf3Δ T1/2 WT

		Nucleotide position^d
		-2 -1 1 2 3 4 5 6 7 8
COX17	Copper metallochaperone involved in cytochrome c oxidase function	CUUGUAUAUA	6.0
COX17		CCUGUAAAUA	6.0
PET123	Small ribosomal subunit protein	CAUGUAUUCG	4.2
PET123	Small ribosomal subunit protein	CAUGUAUAUA	4.2
TUF1	Translation elongation factor Tu	CGUGUAAAUA	3.0
TUF1	Translation elongation factor Tu	UAUGUAUAUGUAAAGA	3.0
ATP11	Chaperone involved in F1F0 ATP synthase assembly	CCUGUAAAUA	2.7
CYT2	Cytochrome c1 heme lyase involved in ubiquinol-cytochrome-c reductase function	CCUGUAAAUA	2.7
MAS6	Component of TIM23 complex that is involved in protein import into matrix and inner membrane	CUUGUAUAUA	2.6
		CAUGUAUGUGUAGAUAUGUACAUA
		CUUGUAUGUU
		UUUGUACUGU
MRPL39	Large ribosomal subunit protein	CCUGUAAAUA	2.3
MRPL39	Large ribosomal subunit protein	UUUGUAUACG	2.3
RSM19	Small ribosomal subunit protein	AGUGUAUAUA	2.0
		CAUGUAAAUA
		GCUGUAUAUA
MRP1	Small ribosomal subunit protein	UCUGUAAAUA	1.6
MRP1	Small ribosomal subunit protein	AUUGUAGCGC	1.6
MRPL6	Large ribosomal subunit protein	CAUGUAUCCU	1.6
MRPL6	Large ribosomal subunit protein	CUUGUAAAUA	1.6
MRP21	Small ribosomal subunit protein	UUUGUAUAUU	1.5
RSM10	Essential small ribosomal subunit protein	CUUGUAAAUA	0.9
RSM10	Essential small ribosomal subunit protein	UUUGUACUAA	0.9
CBS1	Positive regulator of mitochondrial translation		1

^amRNAs listed were analyzed by transcriptional shut off experiments.

^bGene ontology and functional descriptions of the mitochondrial proteins encoded by each mRNA as obtained from the Saccharomyces Genome Database.

^cPredicted 10 nt Puf3p binding elements were identified within 300 bp downstream of the translational stop codon, with the minimal Puf element UGUA underlined.

^dThe nucleotide positions of the Puf elements are numbered, starting with the UGUA element. Positions upstream of the core UGUA are denoted by negative numbers. Puf3p sequences found within mRNAs are compared with the predicted Puf3p regulatory element (C/U)(A/C/U)UGUA(A/U)AUA (24). Positions conserved within the predicted sequence are in black, while positions that are not conserved are in gray.

^eFor each transcript, the fold difference between the average half-life in the puf3Δ versus WT strain is shown.