| Material | Manufacturer |
|---|---|
| Stratalinker UV crosslinker 2400 | Stratagene |
| 4-Thiouridine | Sigma (T4509) |
| Protein G Dynabeads | Life Technologies (10004D) |
| Protein A Dynabeads | Life Technologies (10002D) |
| Protease Inhibitor Cocktail Set III | Calbiochem/Merck (539134-1SET) |
| ANTI-RNase | Life Technologies (AM2692) |
| RNase I | Life Technologies (AM2295) |
| Turbo DNase | Life Technologies (AM2238) |
| T4 PNK plus 10x PNK buffer | NEB (M0201L) |
| RNasin | Promega (N2515) |
| Proteus Clarification Mini Spin Columns | Generon (GEN-MSF500) |
| T4 RNA Ligase I | NEB (M0204L) |
| Pre-adenylated adapter L3-App | IDT (rAppAGATCGGAAGAGCGGTTCAG/ddC/) |
| ATP [γ-32P] | Perkin Elmer (NEG502A250UC) |
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.