Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
MUC5AC primers used for PCR and qPCR analyses
| MUC5AC promoter region | Reference | Forward primer 5′→3′ | Reverse primer, 5′→3′ |
|---|---|---|---|
| Proximal, TATA; nt: −254 to +50 | (31) | cagggagagtctagggtg | cattgtgtggacggcggggaagag |
| Mucin regulatory domain, nt: −1022 to −759 | (31, 8) | cacaacagcaccttctcag | cagcctccaggcaaatgatag |
| Distal: nt: 3685 to −3540 | (16) | tgagggaggagaaagctgtg | cgtgacctctgaacagtctga |
| 3'-Untranslated region | (4) | gctacaccgaggtggaaga | ccacaccctccacaagaaag |
