TABLE 1.

Sequences of the oligonucleotides used in this study

Oligonucleotide	Sequence/position	Used in:
dnaK-F	12,136GACCGAATTCATAGTGGAGACG12,157a	PCR amplification of the dnaK gene
dnaK-R	14,113CCCGTGTCAGTATAATTACCC14,093	PCR amplification of the dnaK gene
sbmA-del-F	395,804CGGTCATGCGGTTAATACACAG395,825	PCR amplification of the sbmA gene
sbmA-del-R	397,168CCTGACTACTACACCCCGCTAA397,147	PCR amplification of the sbmA gene
DB-F	390,900GCGTTGACCGAATCTACTGGGT390,921	Mapping of the deletion boundaries in E. coli C600 mutants
DB-R	397,995CACCTTTCTCTAACTGACGGCG397,974	Mapping of the deletion boundaries in E. coli C600 mutants
DB-R1	397,410GGTCAATCTCTTGCCAGGCGAT397,389	Mapping of the deletion boundaries in E. coli C600 mutants
sbmA-pET22-F	GCATCACATATGTTTAAGTCTTTTTTCCAb	Cloning of sbmA in E. coli C600 mutants Mut2 to Mut4
sbmA-pET22-R	ACATGCGAGCTCGCTCAAGGTATGGGGc	Cloning of sbmA in E. coli C600 mutants Mut2 to Mut4
T7 forward	CCCGCGAAATTAATACGACTCACTA	Sequencing of sbmA-complemented and resistant mutants
T7 reverse	GCTAGTTATTGCTCAGCGG	Sequencing of sbmA-complemented and resistant mutants

^aNumbers indicate nucleotide positions with reference to the published genome of E. coli K-12 substrain W3110 (NCBI accession number NC_007779.1).

^bThe NdeI restriction site is underlined.

^cThe SacI restriction site is underlined.