TABLE 2.
Primers used in this study
| Name | DNA sequence, 5′–3′ | Genomic coordinates | Additional information |
|---|---|---|---|
| Stx2F-22017 | GTCACAGCAGAACCTTACG | NAa | Reference 51 |
| Stx2R-22711 | ACCCACATACCACGAATCAG | NA | Reference 51 |
| Seq9F | GCAATCGGTCACTGGTTCG | NA | Reference 52 |
| Seq10R | CAGATTACACTTGTTACCCAC | NA | Reference 52 |
| WZStx2fF1 | CTGCCGGTTCAGACT | 10–24 of accession no. AB232172 | For PCR and sequencing of 2f variants |
| WZStx2fR1 | ACGAAAACACTGACCAA | 1352–1368 of accession no. AB232172 | For PCR and sequencing of 2f variants |
| WZStx2fF2 | TTCCTGGCGCTGCCG | 1–15 of accession no. AB232172 | For PCR and sequencing of 2f variants |
| WZstx2fR2 | AACAAAAGACGCGCA | 1295–1309 of accession no. AB232172 | For PCR and sequencing of 2f variants |
| WZstx2fF3 | TTGAATGTTAGAGGCCTTG | 260–278 of accession no. AB232172 | For PCR and sequencing of 2f variants |
| WZstx2fR3 | ACGGAGGTGGTTAAAT | 295–310 of accession no. AB232172 | For PCR and sequencing of 2f variants |
| WZstx2fF4 | TTGCAGTTTTATTCGGTCTC | 1029–1048 of accession no. AB232172 | For PCR and sequencing of 2f variants |
| WZstx2fR4 | GTCAACATCCTGAGCCGTCAT | 677–697 of accession no. AB232172 | For PCR and sequencing of 2f variants |
| WZstx2f6 | TCCAGAAACAAAAGACGCGCATA | 1293–1315 of accession no. AB232172 | For PCR and sequencing of 2f variants |
| WZstx2gF1 | AACGGATGATATTGCAGG | 80–97 of accession no. AY095209 | For PCR and sequencing of 2g variants |
| WZstx2gR1 | TAACAAATGCTCACTCTGAC | 1785–1804 of accession no. AY095209 | For PCR and sequencing of 2g variants |
| WZstx2gF2 | CGGGTGAATAAAGGAGTTAAG | 1420–1440 of accession no. AY095209 | For PCR and sequencing of 2g variants |
| WZstx2gR2 | ATTCAGTATAACGGCCACA | 1238–1256 of accession no. AY095209 | For PCR and sequencing of 2g variants |
| WZ stx2gF3 | AACGGATGATATTGCAGGAT | 80–99 of accession no. AY095209 | For PCR and sequencing of 2g variants |
| WZstx2gR3 | ACTGGACTTGATTGTGAC | 1643–1660 of accession no. AY095209 | For PCR and sequencing of 2g variants |
| WZstx2gF4 | ATGCAAATCAGTCGTCAC | 918–935 of accession no. AY095209 | For PCR and sequencing of 2g variants |
| WZstx2gF5 | GATAGACTTTTCGACTCAAC | 548–567 of accession no. AY095209 | For PCR and sequencing of 2g variants |
| WZstx2gF6 | CAACGCGCCATACTTATTC | 93–111 of accession no. AY286000 | For PCR and sequencing of 2g variants |
| WZstx2gR4 | ACACTGTTACCCACATACC | 1450–1468 of accession no. AY286000 | For PCR and sequencing of 2g variants |
| WZstx2gF7 | GCTTTTGCGGGCCTTTTTT | 119–137 of accession no. AY286000 | For PCR and sequencing of 2g variants |
| WZstx2gR5 | ACCCACATACCACGAATCA | 1442–1460 of accession no. AY286000 | For PCR and sequencing of 2g variants |
| WZ14F | CCGKCAACCTTCACTGTAAATGTG | 1353368–1353391 of accession no. AY286000 | For PCR and sequencing of 2a variants |
| WZstx2F1 | CACTCGGGCTTTTTTACA | 1353808–1353825 of accession no. AY286000 | For PCR and sequencing of 2a variants |
| WZstx2R1 | CATACCGCCATTAGCTCA | 1641076–1641093 of accession no. AY286000 | For PCR and sequencing of 2a variants |
| WZX07865F1 | TCCATTATCTGCATTATGC | 55–73 of accession no. AY286000 | For PCR and sequencing of 2a variants |
| WZX07865F2 | TCGACACGGGTTCGGTGGTACC | 1643–1664 of accession no. AY286000 | For PCR and sequencing of 2a variants |
| M13F | GTAAAACGACGGCCAG | NA | M13 cloning primers for insert confirmation |
| M13R | CAGGAAACAGCTATGAC | NA | M13 cloning primers for insert confirmation |
a
NA, not available.