Skip to main content
PMC home page
Infection and Immunity logoLink to Infection and Immunity
. 2014 May;82(5):1793–1800. doi: 10.1128/IAI.01670-13

IcgA Is a Virulence Factor of Rhodococcus equi That Modulates Intracellular Growth

Xiaoguang Wang a, Garry B Coulson b,*, Aleksandra A Miranda-CasoLuengo a,*, Raúl Miranda-CasoLuengo a, Mary K Hondalus b, Wim G Meijer a,✉
Editor: B A McCormick
PMCID: PMC3993432  PMID: 24549327

Abstract

Virulence of the intracellular pathogen Rhodococcus equi depends on a 21.3-kb pathogenicity island located on a conjugative plasmid. To date, the only nonregulatory pathogenicity island-encoded virulence factor identified is the cell envelope-associated VapA protein. Although the pathogenicity islands from porcine and equine R. equi isolates have undergone major rearrangements, the virR operon (virR-icgA-vapH-orf7-virS) is highly conserved in both, suggesting these genes play an important role in pathogenicity. VirR and VirS are transcriptional regulators controlling expression of pathogenicity island genes, including vapA. Here, we show that while vapH and orf7 are dispensable for intracellular growth of R. equi, deletion of icgA, formerly known as orf5, encoding a major facilitator superfamily transport protein, elicited an enhanced growth phenotype in macrophages and a significant reduction in macrophage viability, while extracellular growth in broth remained unaffected. Transcription of virS, located downstream of icgA, and vapA was not affected by the icgA deletion during growth in broth or in macrophages, showing that the enhanced growth phenotype caused by deletion of icgA was not mediated through abnormal transcription of these genes. Transcription of icgA increased 6-fold within 2 h following infection of macrophages and remained significantly higher 48 h postinfection compared to levels at the start of the infection. The major facilitator superfamily transport protein IcgA is the first factor identified in R. equi that negatively affects intracellular replication. Aside from VapA, it is only the second pathogenicity island-encoded structural protein shown to play a direct role in intracellular growth of this pathogenic actinomycete.

INTRODUCTION

The genus Rhodococcus contains over 40 species, most of which are characterized by an enormous metabolic diversity that has many biotechnological applications (1). The only animal pathogen of this genus, Rhodococcus equi, has a wide host range that includes young foals, cattle, and pigs, as well as immunosuppressed humans (2). In humans and foals, R. equi is predominantly associated with pyogranulomatous cavitating pneumonia, although other clinical manifestations, including ulcerative enteritis and osteomyelitis, also may occur (2, 3). R. equi is an intracellular parasite of macrophages that prevents maturation of the early endosome and grows within the resulting compartments, eventually leading to necrotic death of the phagocyte (4–6). A number of virulence and virulence-associated factors have been identified, including cytoadhesive pili (7), the hydroxamate siderophore requichelin (8), and isocitrate lyase, the key enzyme of the glyoxylate bypass (9). In addition to these chromosomally encoded factors, a 21.3-kb pathogenicity island containing 26 coding sequences located on a conjugative plasmid is essential for growth in macrophages and development of disease in animals (10–13).

To date, the only pathogenicity island-encoded proteins that have been shown to play a role in virulence are the cell envelope-associated virulence factor VapA and two transcriptional regulators, VirR (Orf4) and VirS (Orf8), that regulate expression of vapA and a number of other virulence plasmid genes (14–16). Interestingly, the pathogenicity island encodes five additional VapA homologues (VapC, VapD, VapE, VapG, and VapH) as well as three vap pseudogenes (13, 16–18). Deletion of vapA while retaining the other vap genes completely attenuated the resulting mutant strain in macrophages and in mouse model systems, suggesting that these VapA homologues, including VapH, are not functionally identical to VapA (14). Their role in pathogenicity remains unclear.

Although the backbone of virulence plasmids from equine and porcine isolates is virtually identical, the pathogenicity islands of these plasmids have undergone major rearrangements (13). The only highly conserved region within the pathogenicity islands encompasses the virR operon, containing virR-icgA(orf5)-vapH-orf7-virS, suggesting that all five genes, not just virR and virS, play an important role in virulence (13). The orf7 gene does not share sequence similarity with any known gene, and it does not contain conserved domains. The icgA gene encodes a permease that belongs to the major facilitator superfamily (16), a group of proteins that transport a wide variety of structurally diverse compounds across the cell membrane. They represent the largest family of secondary transport proteins and are found in all domains of life (19).

This study examines the influence of icgA (orf5), vapH, and orf7 on intracellular growth of R. equi. While we could not identify a role for the latter two genes, we demonstrated that icgA, a gene that is induced following phagocytosis, is a negative modulator of intracellular growth, and after VapA it is only the second pathogenicity island-encoded nonregulatory protein shown to play a direct role in intracellular growth of this pathogenic actinomycete. Therefore, we propose to rename orf5 (18) as icgA (intracellular growth).

MATERIALS AND METHODS

Bacterial strains, plasmids, and growth conditions.

Bacterial strains and plasmids used in this study are listed in Table 1. Escherichia coli strains were grown in Luria-Bertani (LB) broth, and R. equi strains were grown in LB or in brain heart infusion (BHI) broth. R. equi was also grown in minimal medium (20) supplemented with 20 mM acetate. Where appropriate, apramycin (30 μg/ml for E. coli, 80 μg/ml for R. equi) and hygromycin (180 μg/ml) were added to the medium. Agar was added (1.5% [wt/vol]) for solid media.

TABLE 1.

Bacterial strains and plasmids used in this study

Strain or plasmid Genotype or characteristic(s) Source or reference
E. coli DH5α F− Φ80lacZΔM15 Δ(lacZYA-argF)U169 recA1 endA1 hsdR17 (rK− mK+) phoA supE44 λ- thi-1 gyrA96 relA1 Bethesda Research Laboratories
Rhodococcus equi strains
    103S Virulent strain 35
    103SP− Virulence plasmid cured strain 36
    ΔvapG ΔvapG, Hygr 12
    ΔvapGΔ(icgA-vapH-orf7) ΔvapG Δ(icgA-vapH-orf7), Hygr This study
    ΔicgA ΔicgA This study
    ΔvapH ΔvapH This study
    Δorf7 Δorf7 This study
    ΔvapGΔ(icgA-vapH-orf7)/(icgA-vapH-orf7) ΔvapG Δ(icgA-vapH-orf7), Hygr, pCOMP This study
    ΔicgA/icgA ΔicgA pAI35 This study
Plasmids
    pSelAct Aprr, lacZ, codA::upp 23
    pSelAct-Δ(icgA-vapH-orf7) pSelAct derivative containing fragments upstream of orf7 and downstream of icgA This study
    pSelAct-ΔicgA pSelAct derivative containing 1.3-kb DNA fragments upstream and downstream of icgA This study
    pSelAct-ΔvapH pSelAct derivative containing 1.3-kb DNA fragments upstream and downstream of vapH This study
    pSelAct-Δorf7 pSelAct derivative containing 1.3-kb DNA fragments upstream and downstream of orf7 This study
    pBlueRegP1 pBluescript KS with a 6,680-bp fragment containing orf3, virR, icgA, vapH, orf7, virS 16
    pSET152 ΦC31 integrase attP, Aprr 37
    pSET152.vapG pSET152 derivative containing Phsp60::vapG 12
    pCOMP pSET152.vapG derivative containing icgA, vapH, and orf7 This study
    pAI35 pSET152 derivative containing virR and icgA This study
Open in a new tab

DNA manipulations.

Chromosomal DNA was isolated as described previously (21). Plasmid DNA was isolated using the High Pure plasmid isolation kit as described by the manufacturer (Roche). DNA fragments were isolated from agarose gels using the QIAquick gel extraction kit as described by the manufacturer (Qiagen). PCR was performed using Taq DNA polymerase (Promega) or Phusion DNA polymerase (NEB) as described by the manufacturer. Oligonucleotides used in this study are listed in Table 2.

TABLE 2.

Oligonucleotides used in this study

Oligonucleotide Sequence (5′–3′) Purpose Reference or source
icgA_upF ACTAGAATTCGCGAGGCCATCGAAGC Plasmid construction This study
icgA _upR AATAGGATCCCGCAACTCCGATCAGG Plasmid construction This study
orf7_downF GTATGGATCCTTTCCGCGATGAGTTCAG Plasmid construction This study
orf7_downR TTAACGGCCGACCGTATGACCATTTCC Plasmid construction This study
icgA _1275AF CGCCGAATTCGCCCGCATTGAACGACAGGT Plasmid construction This study
icgA _1275AR GCTAAAGCTTCATCATCCCCTCTGCAACTC Plasmid construction This study
icgA _1282BF GCGGAAGCTTTAGATAACGCAGGAGGGACC Plasmid construction This study
icgA _1282BR GGATTCTAGAAGATGAGCATTGCCCTAACCA Plasmid construction This study
vapH_1291AF GCTGGGATCCTGTTTGCGATTGGGCAGGAT Plasmid construction This study
vapH _1291AR GGCCAAGCTTCATAAATGCACCCCTCTCGT Plasmid construction This study
vapH _1287BF CCTGAAGCTTGCGTAGTCCAAGCGAAGAAT Plasmid construction This study
vapH _1287BR GCGCGCGGCCGCCCCCATACCGTTTCGAT Plasmid construction This study
orf7_1289AF CGCCCCCGGGTTTGAGCCGTGACCCTTTTAA Plasmid construction This study
orf7_1289AR GCCCAAGCTTCACCTCACAGAATCGTTTACT Plasmid construction This study
orf7_1289BF GCGGAAGCTTTGAGTTCAGCGACAGGAGTG Plasmid construction This study
orf7_1289BR TGAAACTAGTTACGAAGTGCCGTCTACCCA Plasmid construction This study
icgA_8F2 AAGCACATGTTTATGCTCCGCAGGCC Plasmid construction This study
orf7_R ACCCACATGTAGATGAGCATTGCCCTAACC Plasmid construction This study
icgA _IF CGGCTGTCGTAATTCTGTTC Genotyping of ΔicgA strain This study
icgA _IR AGCGTGTAAATAGACGAGGC Genotyping of ΔicgA strain This study
icgA _EF ACCTCGTCTGCGACTCTGT Genotyping of ΔicgA strain This study
icgA _ER GTCTCGTCCACTTTGGTTTC Genotyping of ΔicgA strain This study
vapH _IF CATTACCAGATGGTCCCACA Genotyping of ΔvapH strain This study
vapH _IR CGCTGTATGTTGTCGGTGAA Genotyping of ΔvapH strain This study
vapH _EF AACCAAAGTGGACGAGACGA Genotyping of ΔvapH strain This study
vapH _ER GAGCGGAAGTCCGATAGTTT Genotyping of ΔvapH strain This study
orf7_IF TTCCGCTCGACCTGCTTTC Genotyping of Δorf7 strain This study
orf7_IR GGCCACCTTCTTCCACTGA Genotyping of Δorf7 strain This study
orf7_EF TAATCGGTATTGGCGGAGGT Genotyping of Δorf7 strain This study
orf7_ER CTAACCATTATCAGCGAGGC Genotyping of Δorf7 strain This study
008_F GAACAACTGGGAATGGTGGT Quantification of virS 29
008_R GTTCGCCGTTTCTAGACGAA Quantification of virS 29
012_F CAGTACGACGTTCACGGAGA Quantification of vapA 38
012_R CACGGCGTTGTACTGGAAC Quantification of vapA 38
006_F AGGGTTATGCAGGTGGATTG Quantification of vapH 29
006_R TACCGATTACGGAGCTCACC Quantification of vapH 29
007_NF ATGCACTCCCTGAAAACTATC Quantification of orf7 29
007_NR GGTGGGCTGGATTGACGCGCA Quantification of orf7 29
gyrB_F GTCGAGCAGGGTCAAGTGTA Quantification of gyrB This study
gyrB_R AGCTCCTTGGCGTTCATCT Quantification of gyrB This study
16SrRNAF200 ACGAAGCGAGAGTGACGGTA Quantification of 16S rRNA 26
16SrRNAR200 ACTCAAGTCTGCCCGTATCG Quantification of 16S rRNA 26
Open in a new tab

Plasmid construction.

To construct the plasmid for generating a simultaneous icgA, vapH, and orf7 mutant, primer pairs icgA_upF/icgA_upR and orf7_downF/orf7_downR were used to amplify upstream and downstream flanking regions of icgA and orf7, respectively, which were subsequently digested with BamHI and ligated. Primer pair icgA_upF F/orf7_downR was used to amplify the resulting ligation product, which was cloned into the EcoRI/EagI sites of pSelAct, yielding pSelAct-Δ(icgA-vapH-orf7).

To construct the plasmids required for generating individual unmarked deletion mutants of icgA, vapH, and orf7, an approach similar to that outlined above was employed. A 1.3-kb DNA fragment upstream of the gene of interest was amplified using primer pair icgA_1275AF/icgA_1275AR (icgA), vapH_1291AF/vapH_1291AR (vapH), or orf7_1289AF/orf7_1289AR (orf7). Likewise, a 1.3-kb DNA fragment downstream of the gene of interest was amplified using primer pair icgA_1282BF/icgA_1282BR (icgA), vapH_1287BF/vapH_1287BR (vapH), or orf7_1289BF/orf7_1289BR (orf7). Following purification and ligation of the upstream and downstream fragments, a 2.6-kb DNA fragment was created which contained an in-frame deletion of the respective gene. These fragments were subsequently amplified by PCR and cloned into the relevant restriction sites (icgA, EcoRI/XbaI; vapH, BamHI/NotI; orf7, XmaI/SpeI) of pSelAct, producing constructs pSelAct-ΔicgA, pSelAct-ΔvapH, and pSelAct-Δorf7.

The complementing plasmid for the Δ(icgA-vapH-orf7) mutation was constructed by amplifying a 3-kb fragment containing icgA, vapH, and orf7 and the PicgA promoter using primers icgA_8F2 and orf7_R and then digested with PciI. The resulting product was ligated to pSET152.vapG, which had been digested previously with PciI, giving rise to pCOMP.

To complement the icgA deletion, a 3,316-bp fragment containing the intergenic region orf3-virR, vir, and icgA was obtained by digestion of pBlueReg1with StuI and PvuII. This fragment was ligated in pSET152 digested with NotI and PciI and treated with the Klenow fragment, generating pPAI35.

Mutant construction.

R. equi was made electrocompetent and transformed by electroporation as previously described (22). Unmarked deletion mutants were constructed as described previously (23). Briefly, after electroporating pSelAct derivatives into R. equi 103S, apramycin-resistant transformants were grown for 20 h in LB medium at 37°C. Aliquots (100 μl) of these cultures were plated in 10−4 to 10−6 dilutions onto acetate-containing minimal medium agar plates supplemented with 100 μg/ml 5-fluorocytosine and incubated for 3 days at 37°C.

Genotypes of the resulting mutants were analyzed by PCR using primers that are complementary to sequences located outside and inside the intended deleted DNA fragment. The genotype of R. equi ΔicgA was confirmed by PCR using primer pairs icgA_IF/icgA_IR and icgA_EF/icgA_ER. The former primer pair yields a 489-bp amplicon when wild-type DNA is used and no amplicon when mutant DNA is used as the template, and the latter primer pair yields a 1,125-bp or a 217-bp amplicon for the wild type and the icgA deletion mutant, respectively.

The genotype of R. equi ΔvapH was checked by PCR with primer pairs vapH_IF/vapH_IR and vapH_EF/vapH_ER. The former gives a 291-bp amplicon with the wild-type strain and no amplicon with the mutant, and the latter gives a 687-bp or 124-bp PCR product for the wild type and vapH deletion mutant, respectively.

The genotype of R. equi Δorf7 was checked by PCR with primer pairs orf7_IF/orf7_IR and orf7_EF/orf7_ER. Amplification with the former pair gives an amplicon (274-bp) only when the wild type is used. The latter primer pair gives a 614- or 189-bp amplicon for the wild type and orf7 deletion mutant, respectively.

The genotype of R. equi ΔvapGΔ(icgA-vapH-orf7) was checked with primer pair icgA_upF/orf7_downR, which gives a 3,801-bp or a 1,456-bp PCR product for the wild type and deletion mutant, respectively. The orf7_IF and orf7_IR primer pair gives a PCR product (274 bp) only in the wild type.

Murine J774A.1 and bone marrow-derived macrophages.

Murine J774A.1 cell macrophages were maintained in Dulbecco's modified Eagle medium (DMEM) supplemented with 10% fetal calf serum (FCS) and 2 mM glutamine and incubated at 37°C in 5% CO2. Murine bone marrow-derived macrophages (BMDMs) were isolated and cultured as previously described (12). For intracellular growth assays, macrophages were seeded in 24-well tissue culture plates at 2 × 105 cells per well and incubated at 37°C, 5% CO2 overnight. Cell viability was assessed with the trypan blue exclusion assay as described elsewhere (6).

Intracellular growth of R. equi in macrophages.

Overnight broth cultures of bacteria at an optical density at 600 nm (OD600) of 1.0 (∼2 × 108 CFU/ml) were pelleted, washed once with phosphate-buffered saline (PBS), and resuspended in PBS to the same OD600. Macrophage monolayers were washed once with warm DMEM, and the medium was replaced with fresh DMEM supplemented with 10% FCS, 10% CSF-1 conditioned supernatant (BMDMs), and 2 mM glutamine (complete DMEM). Bacteria were added at a multiplicity of infection (MOI) of ∼10 bacteria per macrophage. Bacterial incubation with macrophages proceeded for 1 h at 37°C. The monolayers were subsequently washed repeatedly with prewarmed DMEM to remove unbound bacteria. The medium was replaced with complete DMEM supplemented with 20 μg/ml amikacin sulfate (BMDM) or 5 μg/ml vancomycin (J774A.1). At various times postinfection, macrophage monolayers were lysed with water (500 μl), and dilutions of the lysate were spread onto BHI agar and plates incubated (37°C; 48 h) to enumerate CFU.

RNA isolation.

RNA was isolated from R. equi grown in vitro as described previously (16). R. equi RNA was isolated from macrophages following phagocytosis of the pathogen using a guanidine thiocyanate-based lysis buffer (4 M guanidine thiocyanate, 0.5% [wt/vol] sodium N-lauryl sarcosine, 25 mM sodium citrate, and 0.1 M β-mercaptoethanol) as previously described (24, 25). Samples were vortexed and passed through a needle to shear macrophage DNA and to reduce viscosity. Intracellular bacteria were recovered by centrifugation. Pelleted bacteria were lysed using TRIzol (Sigma) and physically disrupted with zirconia beads in a MagnaLyser instrument (Roche). Total RNA was isolated by chloroform extraction followed by DNA digestion with Turbo DNase (Ambion) and applied to a Qiagen RNeasy column with a second, in-column DNA digestion with RNase-free DNase as previously described (26).

Reverse transcription and PCR.

Reverse transcriptase reactions using random primers (Promega) were performed with 1 U Improm II reverse transcriptase (Promega) by following the manufacturer's recommendations with 100 ng of total RNA as the template in a final volume of 20 μl. The resulting product was used in either endpoint or quantitative PCR. For the former, the reaction mixture (1 μl) was used as a template for PCR amplification with Taq DNA polymerase as described by the manufacturer (Promega). Transcript levels of virS, vapA, and icgA were assessed by quantitative PCR using 16S rRNA as an internal control as described previously (27). Normalized transcript levels of individual observations were calibrated against the geometric mean of the transcript levels of R. equi 103S. The data reported in this paper represent the results of three independent experiments in which each sample was analyzed in duplicate.

Statistical analysis.

Statistical analyses were performed using the SPSS statistical package (version 17.0.1; Chicago, IL). Normal distribution and equal variance of the data were assessed using the Shapiro-Wilk and Levene tests, respectively. Comparison of the means in fold replication and intracellular bacterial numbers between bacterial strains was assessed using a one-way analysis of variance (ANOVA). When appropriate, multiple pairwise comparisons were done using Tukey's honestly significant difference (HSD) test. A P value of less than 0.05 was considered significant.

RESULTS

Deletion of the pathogenicity island genes icgA, vapH, and orf7 results in enhanced intracellular growth.

A mutant lacking the icgA, vapH, and orf7 genes was constructed to determine whether these genes play a role in growth of R. equi in macrophages. The phenotypically wild-type-like R. equi ΔvapG strain (12) was used as the background for construction of the icgA-vapH-orf7 deletion mutant. This allowed the use of the hph gene (28), which marks the vapG deletion and confers hygromycin resistance, to select for the presence of the virulence plasmid throughout the mutagenesis procedure. To confirm the absence of transcripts from the targeted genes and the continued expression of vapA in R. equi ΔvapGΔ(icgA-vapH-orf7), RNA was isolated from these strains and reverse transcribed, followed by PCR analysis using primer pairs (Table 2) that individually amplify icgA, vapH, orf7, or vapA cDNA (Fig. 1A). Amplicons were not observed when primer pairs designed to amplify icgA, vapH, and orf7 were used, confirming their absence from R. equi ΔvapGΔ(icgA-vapH-orf7) (Fig. 1A). In contrast, all primer pairs yielded an amplicon of the expected size when wild-type R. equi 103S cDNA was used as the control template (Fig. 1A). Importantly, transcription of vapA was maintained in R. equi ΔvapGΔ(icgA-vapH-orf7) (Fig. 1A).

FIG 1.

FIG 1

Open in a new tab

Reverse transcriptase PCR of pathogenicity island genes confirming the phenotypes of R. equi ΔvapGΔ(icgA-vapH-orf7) and individual icgA, vapH, and orf7 deletion mutants. Total RNA was extracted and used to generate cDNA from wild-type and mutant strains, followed by PCR using primers (Table 2) that specifically amplify internal regions of icgA, vapH, orf7, vapA, and the chromosomal gene gyrB. Standard DNA markers (M) are indicated on the left of each panel. (A) Lane 1, R. equi 103S; lane 2, R. equi 103SP−; lane 3, R. equi ΔvapGΔ(icgA-vapH-orf7); lane 4, R. equi ΔvapGΔ(icgA-vapH-orf7)/(icgA-vapH-orf7). (B) Lane 1, R. equi 103S; lane 2, R. equi 103SP−; lane 3, R. equi ΔicgA; lane 4, R. equi ΔicgA/icgA; lane 5, R. equi ΔvapH; lane 6, R. equi 103S; lane 7, R. equi Δorf7.

Intracellular growth of R. equi ΔvapGΔ(icgA-vapH-orf7) in murine bone marrow-derived macrophages was compared to that of the wild-type strain, R. equi 103S, and the virulence plasmid-cured strain, 103SP− (Fig. 2). While the virulent strain R. equi 103S multiplied 10-fold over a 48-h period, the plasmid-cured strain failed to replicate in the macrophages, as expected. Surprisingly, intracellular growth of R. equi ΔvapGΔ(icgA-vapH-orf7) significantly (P < 0.001) exceeded that of the wild-type strain, with mutant CFU numbers increasing 43-fold 48 h postinfection (Fig. 2). Complementation of R. equi ΔvapGΔ(icgA-vapH-orf7) with the integrative plasmid pCOMP containing icgA, vapH, and orf7 restored transcription of these genes (Fig. 1A, lane 4) as well as wild-type intracellular growth characteristics (Fig. 2). This demonstrates that the loss of a DNA fragment containing icgA, vapH, and orf7 was responsible for the observed enhanced intracellular growth phenotype.

FIG 2.

FIG 2

Open in a new tab

Deletion of a DNA fragment containing icgA, vapH, and orf7 results in enhanced intracellular growth. Intracellular growth of R. equi strains was assessed in murine bone marrow-derived macrophage monolayers infected with R. equi 103S, 103SP−, R. equi ΔvapGΔ(icgA-vapH-orf7), and R. equi ΔvapGΔ(icgA-vapH-orf7)/(icgA-vapH-orf7) (complemented strain) at an MOI of 10. Following incubation for 1 h to allow phagocytosis, monolayers were washed and treated with amikacin to kill any remaining extracellular bacteria (t = 0 h). Macrophage monolayers were lysed in triplicate at 1 h, 24 h, and 48 h postinfection. Lysates were plated onto BHI agar plates to determine the associated CFU. (A) Intracellular growth of R. equi strains following infection of macrophages. (B) Fold change in CFU of intracellular bacteria at 24 h and 48 h postinfection relative to 1 h postinfection (hpi). Error bars represent the standard deviations. Horizontal lines represent the statistical significance of fold changes in CFU per monolayer for R. equi strains represented by bars at the end of each line. N.S., not significant. Data are representative of three independent experiments.

IcgA modulates intracellular growth.

The enhanced intracellular growth phenotype of R. equi carrying a mutated virulence plasmid in which icgA, vapH, and orf7 were deleted prompted us to construct individual unmarked deletions of these genes in R. equi 103S to identify which gene is associated with this phenotype. The absence of icgA, vapH, or orf7 transcripts in the respective mutants was confirmed by reverse transcriptase PCR, which showed that only transcription of the targeted gene was abolished (Fig. 1B). As before, the continued expression of vapA was confirmed in the individual mutants (Fig. 1B).

Intracellular growth of R. equi ΔvapH (Fig. 3A) and R. equi Δorf7 (Fig. 3B) was not significantly different from that of the wild-type strain. In contrast, deletion of icgA led to significantly increased intracellular growth (P < 0.001) of the mutant relative to the wild-type strain (Fig. 3C) and was comparable to intracellular growth of R. equi ΔvapGΔ(icgA-vapH-orf7) (Fig. 2). Restoration of icgA transcription by complementation with pAI35 (Fig. 1B, lane 4) completely reversed the enhanced growth phenotype to normal wild-type intracellular growth levels (Fig. 3C). Growth of R. equi ΔicgA in LB media was not different from that of the wild-type strain, R. equi 103S, or R. equi ΔicgA/icgA, showing that icgA affects intracellular but not extracellular growth (Fig. 4).

FIG 3.

FIG 3

Open in a new tab

Deletion of icgA results in an enhanced intracellular growth phenotype, whereas vapH and orf7 are dispensable for growth in macrophages. Murine bone marrow-derived macrophage monolayers were infected with R. equi wild-type and mutant strains at an MOI of 10. Following incubation for 1 h to allow phagocytosis, monolayers were washed and treated with amikacin to kill any remaining extracellular bacteria (t = 0 h). Macrophage monolayers were lysed in triplicate at 1 h, 24 h, and 48 h postinfection. Lysates were plated onto BHI agar plates to determine the associated CFU. Shown are the fold changes in CFU of intracellular bacteria at 24 h and 48 h postinfection relative to levels at 1 h postinfection. (A) Infection of macrophage monolayers with R. equi 103S and R. equi ΔvapH. (B) Infection of macrophage monolayers with R. equi 103S and R. equi Δorf7. (C) Infection of macrophage monolayers with R. equi 103S, R. equi 103SP−, R. equi ΔicgA, and R. equi ΔicgA/icgA. Error bars represent the standard deviations. Horizontal lines represent the statistical significance of fold changes in CFU per monolayer for R. equi strains, represented by bars at the end of each line. Data are representative of three independent experiments. N.S., not significant; hpi, hours postinfection.

FIG 4.

FIG 4

Open in a new tab

Deletion of icgA does not affect extracellular growth of R. equi. R. equi 103S, R. equi ΔicgA, and R. equi ΔicgA/icgA were grown in LB broth under vapA-inducing growth conditions (pH 5.5, 37°C). Data represent averages from three independent experiments. Standard deviations did not exceed 10% and are omitted for clarity.

Deletion of icgA does not affect transcription of virS and vapA.

To exclude the possibility that deletion of icgA resulted in abnormal transcription levels of virS, encoding a response regulator controlling vapA transcription, as an explanation of the enhanced intracellular growth phenotype of R. equi ΔicgA, the transcript levels of these genes were determined following growth of the wild type, R. equi ΔicgA, and the complemented strain R. equi ΔicgA/icgA under growth conditions (37°C, pH 5.5) that induce vapA (Fig. 5A). In addition, vapA and virS transcript levels were determined in these strains 24 h postuptake by macrophages (Fig. 5B). No significant differences (P > 0.05) in the virS and vapA transcript levels between the wild-type strain, R. equi ΔicgA, and R. equi ΔicgA/icgA were observed in these strains growing in LB medium or within macrophages. This demonstrated that the enhanced growth phenotype of R. equi ΔicgA was due specifically to the deletion of the icgA gene and was not the result of a secondary effect on virS or vapA transcription.

FIG 5.

FIG 5

Open in a new tab

Enhanced intracellular growth of R. equi ΔicgA is not due to increased transcription of virS or vapA in vitro or in vivo. The transcript levels of virS and vapA were determined following growth of R. equi 103S, R. equi ΔicgA, and R. equi ΔicgA/icgA. The transcript levels of virS and vapA were assessed by quantitative PCR and normalized to 16S rRNA. The data are expressed as a fold change in transcript levels relative to the level for R. equi 103S. (A) R. equi strains were grown in LB broth under vapA-inducing growth conditions (pH 5.5, 37°C). RNA was extracted when the culture reached an OD600 of 1.0. The data are representative of three independent experiments in which each sample was measured in triplicate. (B) Murine J774A.1 macrophages were infected with R. equi strains. Following an incubation period (1 h) to allow phagocytosis, monolayers were washed and treated with vancomycin to kill extracellular bacteria (t = 0 h). At 24 h postinfection, bacterial RNA was extracted from lysed macrophages. Data shown are representative of two independent experiments in which each sample was measured in triplicate. Error bars reflect the standard deviations.

Transcription of icgA is induced following phagocytosis by macrophages.

Our data showed that expression of icgA has a strong negative impact on intracellular growth of R. equi. We previously showed that transcription of icgA during growth in broth is regulated in the same manner as vapA (29); however, regulation of icgA during intracellular growth remains poorly characterized. Therefore, insight into the regulation of icgA transcription levels following phagocytosis is essential to understand the role this gene plays in virulence. Macrophages were infected with the wild-type strain R. equi 103S, followed by extraction of bacterial RNA during the course of the infection. Relative icgA transcript levels were subsequently determined by quantitative PCR. Transcription of icgA was rapidly induced following phagocytosis, resulting in a significant increase (6-fold) by 2 h postinfection, and transcription remained elevated throughout the infection period (Fig. 6).

FIG 6.

FIG 6

Open in a new tab

Transcriptional profile of the icgA gene during infection of macrophages with R. equi 103S. Following a 1-h incubation period to allow phagocytosis, murine macrophage-like cell line J774A.1 monolayers were washed and treated with vancomycin to kill extracellular bacteria (t = 0 h). The icgA transcript levels were determined by reverse transcriptase quantitative PCR using the transcript levels of the 16S rRNA gene as a reference for normalization. Fold changes in gene expression are relative to t = 0. Error bars denote the standard errors of the means. Results are from two independent experiments in which each sample was analyzed in triplicate (*, P < 0.05; **, P < 0.01).

Enhanced intracellular growth of R. equi ΔicgA leads to decreased macrophage viability.

We hypothesized that the enhanced intracellular growth phenotype of R. equi ΔicgA results in decreased macrophage viability. Therefore, macrophage monolayers were infected with the wild-type strain R. equi 103S, R. equi ΔicgA, and the complemented strain R. equi ΔicgA/icgA. While there were no significant differences 24 h postinfection, there was a significant, 40% reduction in the number of macrophages in monolayers infected with R. equi ΔicgA compared to monolayers infected with the wild type or R. equi ΔicgA/icgA at 48 h postinfection (Fig. 7).

FIG 7.

FIG 7

Open in a new tab

Enhanced intracellular growth phenotype of R. equi ΔicgA decreases macrophage viability. Murine J774A.1 macrophages were infected with R. equi 103S, R. equi ΔicgA, and R. equi ΔicgA/icgA. Following an incubation period (1 h) to allow phagocytosis, monolayers were washed and treated with vancomycin to kill extracellular bacteria (t = 0 h). Macrophage viability was assessed at 0, 24, and 48 h postinfection using the trypan blue exclusion assay. Results are from three independent experiments (*, P < 0.05). Error bars reflect the standard deviations.

DISCUSSION

The virR operon consists of five genes, two of which, virR and virS, encode transcriptional regulators that control the transcription of other genes in the pathogenicity island, including that of the virulence factor vapA (15, 16). Despite major genetic rearrangements in the pathogenicity island of porcine and equine isolates, the virR operon is highly conserved (13). This strongly suggests that the other three genes of this operon, icgA, vapH, and orf7, also play a role in virulence of R. equi. VapH is a homologue of VapA, displaying extensive sequence similarities in the central and carboxy-terminal parts of the protein (13, 18). Therefore, its conservation suggests that it has a function similar to that of VapA. However, while deletion of vapA completely attenuates R. equi (14), deletion of vapH had no effect on intracellular growth. A similar observation was made following deletion of vapG (12). Thus, VapA remains the only Vap protein that has been shown to be essential for growth in macrophages, suggesting that the other Vap proteins are important for proliferation in phagocytic cells of nonequine hosts, or that they play a more subtle role, perhaps in modulating VapA activity. The Orf7 proteins encoded by the equine and porcine R. equi plasmids are 88% identical (13). However, despite a wealth of sequence information of a vast number of organisms, no known Orf7 orthologues exist. In addition, the Orf7 protein does not contain conserved domains that hint at its function. The fact that this protein is, so far, unique to R. equi yet conserved among strains isolated from different hosts suggests its function is uniquely associated with R. equi pathogenesis. Deletion of orf7 did not affect intracellular growth, indicating that it plays a role in another aspect of R. equi infection and host-pathogen interactions.

The IcgA protein belongs to the major facilitator superfamily of transport proteins, which includes 58 distinct families and over 10,000 sequenced members (30). Most of these consist of 400 to 600 amino acids and possess a varied number of transmembrane spanners. Hydropathy analysis of the amino acid sequence and topological studies predict that IcgA possesses a uniform topology of 12 transmembrane-spanning α-helices connected by hydrophilic loops, with both their N and C termini located in the cytoplasm. The N- and C-terminal halves of the protein display weak sequence similarity. The majority of major facilitator superfamily transporter proteins share a similar structure, regardless of their low sequence identity (31). Therefore, it is difficult to predict the substrate that is transported by IcgA.

A number of major facilitator superfamily transporters are virulence factors. For example, deletion of phtA in Legionella pneumophila (32) and three phtA orthologues in Francisella tularensis resulted in reduced intracellular growth and attenuation (33). However, while deletion of icgA did not affect growth in broth, it significantly enhanced intracellular growth compared to that of the wild-type strain. This strongly suggests that the substrate of the IcgA transport protein is produced by the macrophage and serves as a signal to the pathogen that it resides within an intracellular compartment.

Interestingly, transcription of icgA is upregulated under vapA-inducing growth conditions (29) and is also induced during intracellular growth. VapA is an extracellular protein that is essential to prevent endosomal maturation, creating the niche in which R. equi grows (34). Infection of macrophages by R. equi results in necrotic, proinflammatory death of the phagocytic cell (6). Deletion of icgA results not only in enhanced intracellular growth but also in enhanced killing of macrophages. By repressing intracellular bacterial replication, expression of IcgA prolongs the period R. equi is able to reside within the host cell. Therefore, upregulation of icgA following phagocytosis represents a clear adaptation to a pathogenic, intracellular lifestyle and offers an explanation for why this gene is conserved in R. equi strains isolated from different hosts. Therefore, the pathogenicity island has at least two functions: creation of an intracellular niche by inhibition of endosomal maturation by VapA and modulation of intracellular growth by IcgA, allowing this intracellular niche to last longer.

ACKNOWLEDGMENTS

This work was supported in part by funds from the National Institutes of Health (R01 AI060469; awarded to M.K.H.) and by a grant from the Research Stimulus Fund of the Department of Agriculture, Food, and the Marine (RSF 06-379; awarded to W.G.M.).

Footnotes

Published ahead of print 18 February 2014

REFERENCES

  • 1.van der Geize R, Dijkhuizen L. 2004. Harnessing the catabolic diversity of rhodococci for environmental and biotechnological applications. Curr. Opin. Microbiol. 7:255–261. 10.1016/j.mib.2004.04.001 [DOI] [PubMed] [Google Scholar]
  • 2.Muscatello G, Leadon DP, Klay M, Ocampo-Sosa A, Lewis DA, Fogarty U, Buckley T, Gilkerson JR, Meijer WG, Vázquez-Boland JA. 2007. Rhodococcus equi infection in foals: the science of “rattles.” Equine Vet. J. 39:470–478. 10.2746/042516407X209217 [DOI] [PubMed] [Google Scholar]
  • 3.Weinstock DM, Brown AE. 2002. Rhodococcus equi: an emerging pathogen. Clin. Infect. Dis. 34:1379–1385. 10.1086/340259 [DOI] [PubMed] [Google Scholar]
  • 4.Hondalus MK, Mosser DM. 1994. Survival and replication of Rhodococcus equi in macrophages. Infect. Immun. 62:4167–4175 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Fernandez-Mora E, Polidori M, Lührmann A, Schaible UE, Haas A. 2005. Maturation of Rhodococcus equi-containing vacuoles is arrested after completion of the early endosome stage. Traffic 6:635–653. 10.1111/j.1600-0854.2005.00304.x [DOI] [PubMed] [Google Scholar]
  • 6.Lührmann A, Mauder N, Sydor T, Fernandez-Mora E, Schulze-Luehrmann J, Takai S, Haas A. 2004. Necrotic death of Rhodococcus equi-infected macrophages is regulated by virulence-associated plasmids. Infect. Immun. 72:853–862. 10.1128/IAI.72.2.853-862.2004 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Letek M, Gonzalez P, Macarthur I, Rodriguez H, Freeman TC, Valero-Rello A, Blanco M, Buckley T, Cherevach I, Fahey R, Hapeshi A, Holdstock J, Leadon D, Navas J, Ocampo A, Quail MA, Sanders M, Scortti MM, Prescott JF, Fogarty U, Meijer WG, Parkhill J, Bentley SD, Vazquez-Boland JA. 2010. The genome of a pathogenic rhodococcus: cooptive virulence underpinned by key gene acquisitions. PLoS Genet. 6:e1001145. 10.1371/journal.pgen.1001145 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Miranda-Casoluengo R, Coulson GB, Miranda-Casoluengo A, Vazquez-Boland JA, Hondalus MK, Meijer WG. 2012. The hydroxamate siderophore rhequichelin is required for virulence of the pathogenic actinomycete Rhodococcus equi. Infect. Immun. 80:4106–4114. 10.1128/IAI.00678-12 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Wall DM, Duffy PS, Dupont C, Prescott JF, Meijer WG. 2005. Isocitrate lyase activity is required for virulence of the intracellular pathogen Rhodococcus equi. Infect. Immun. 73:6736–6741. 10.1128/IAI.73.10.6736-6741.2005 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Giguère S, Hondalus MK, Yager JA, Darrah P, Mosser DM, Prescott JF. 1999. Role of the 85-kilobase plasmid and plasmid-encoded virulence-associated protein A in intracellular survival and virulence of Rhodococcus equi. Infect. Immun. 67:3548–3557 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Tripathi VN, Harding WC, Willingham-Lane JM, Hondalus MK. 2012. Conjugal transfer of a virulence plasmid in the opportunistic intracellular actinomycete Rhodococcus equi. J. Bacteriol. 194:6790–6801. 10.1128/JB.01210-12 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Coulson GB, Agarwal S, Hondalus MK. 2010. Characterization of the role of the pathogenicity island and vapG in the virulence of the intracellular actinomycete pathogen Rhodococcus equi. Infect. Immun. 78:3323–3334. 10.1128/IAI.00081-10 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Letek M, Ocampo-Sosa AA, Sanders M, Fogarty U, Buckley T, Leadon DP, Gonzalez P, Scortti M, Meijer WG, Parkhill J, Bentley S, Vázquez-Boland JA. 2008. Evolution of the Rhodococcus equi vap pathogenicity island seen through comparison of host-associated vapA and vapB virulence plasmids. J. Bacteriol. 190:5797–5805. 10.1128/JB.00468-08 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Jain S, Bloom BR, Hondalus MK. 2003. Deletion of vapA encoding virulence associated protein A attenuates the intracellular actinomycete Rhodococcus equi. Mol. Microbiol. 50:115–128. 10.1046/j.1365-2958.2003.03689.x [DOI] [PubMed] [Google Scholar]
  • 15.Ren J, Prescott JF. 2004. The effect of mutation on Rhodococcus equi virulence plasmid gene expression and mouse virulence. Vet. Microbiol. 103:219–230. 10.1016/j.vetmic.2004.08.005 [DOI] [PubMed] [Google Scholar]
  • 16.Russell DA, Byrne GA, O'Connell EP, Boland CA, Meijer WG. 2004. The LysR-Type transcriptional regulator VirR is required for expression of the virulence gene vapA of Rhodococcus equi ATCC 33701. J. Bacteriol. 186:5576–5584. 10.1128/JB.186.17.5576-5584.2004 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Polidori M, Haas A. 2006. VapI, a new member of the Rhodococcus equi Vap family. Antonie Van Leeuwenhoek 90:299–304. 10.1007/s10482-006-9073-y [DOI] [PubMed] [Google Scholar]
  • 18.Takai S, Hines SA, Sekizaki T, Nicholson VM, Alperin DA, Osaki M, Osaki D, Nakamura M, Suzuki K, Ogino N, Kakuka T, Dan H, Prescott JF. 2000. DNA sequence and comparison of virulence plasmids from Rhodococcus equi ATCC 33701 and 103. Infect. Immun. 68:6840–6847. 10.1128/IAI.68.12.6840-6847.2000 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Saier MH, Jr, Beatty JT, Goffeau A, Harley KT, Heijne WH, Huang SC, Jack DL, Jahn PS, Lew K, Liu J, Pao SS, Paulsen IT, Tseng TT, Virk PS. 1999. The major facilitator superfamily. J. Mol. Microbiol. Biotechnol. 1:257–279 [PubMed] [Google Scholar]
  • 20.Kelly BG, Wall DW, Boland CA, Meijer WG. 2002. Isocitrate lyase of the facultative intracellular pathogen Rhodococcus equi. Microbiology 148:793–798 [DOI] [PubMed] [Google Scholar]
  • 21.Nagy I, Schoofs G, Compernolle F, Proost P, Vanderleyden J, De Mot R. 1995. Degradation of the thiocarbamate herbicide EPTC (S-ethyl dipropylcarbamothioate) and biosafening by Rhodococcus sp. strain NI86/21 involve an inducible cytochrome P-450 system and aldehyde dehydrogenase. J. Bacteriol. 177:676–687 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Mangan MW, Meijer WG. 2001. Random insertion mutagenesis of the intracellular pathogen Rhodococcus equi using transposomes. FEMS Microbiol. Lett. 205:243–246. 10.1111/j.1574-6968.2001.tb10955.x [DOI] [PubMed] [Google Scholar]
  • 23.van der Geize R, de Jong W, Hessels GI, Grommen AW, Jacobs AA, Dijkhuizen L. 2008. A novel method to generate unmarked gene deletions in the intracellular pathogen Rhodococcus equi using 5-fluorocytosine conditional lethality. Nucleic Acids Res. 36:e151. 10.1093/nar/gkn811 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Butcher PD, Mangan JA, Monahan IM. 1998. Intracellular gene expression. Analysis of RNA from mycobacteria in macrophages using RT-PCR. Methods Mol. Biol. 101:285–306 [DOI] [PubMed] [Google Scholar]
  • 25.Rohde KH, Abramovitch RB, Russell DG. 2007. Mycobacterium tuberculosis invasion of macrophages: linking bacterial gene expression to environmental cues. Cell Host Microbe 2:352–364. 10.1016/j.chom.2007.09.006 [DOI] [PubMed] [Google Scholar]
  • 26.Miranda-Casoluengo R, Duffy PS, O'Connell EP, Graham BJ, Mangan MW, Prescott JF, Meijer WG. 2005. The iron-regulated iupABC operon is required for saprophytic growth of the intracellular pathogen Rhodococcus equi at low iron concentrations. J. Bacteriol. 187:3438–3444. 10.1128/JB.187.10.3438-3444.2005 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Miranda-Casoluengo R, Miranda-Casoluengo AA, O'Connell EP, Fahey RJ, Boland CA, Vazquez-Boland JA, Meijer WG. 2011. The vapA co-expressed virulence plasmid gene vcgB (orf10) of the intracellular actinomycete Rhodococcus equi. Microbiology 157:2357–2368. 10.1099/mic.0.049759-0 [DOI] [PubMed] [Google Scholar]
  • 28.Gritz L, Davies J. 1983. Plasmid-encoded hygromycin B resistance: the sequence of hygromycin B phosphotransferase gene and its expression in Escherichia coli and Saccharomyces cerevisiae. Gene 25:179–188. 10.1016/0378-1119(83)90223-8 [DOI] [PubMed] [Google Scholar]
  • 29.Byrne GA, Russell DA, Chen X, Meijer WG. 2007. Transcriptional regulation of the virR operon of the intracellular pathogen Rhodococcus equi. J. Bacteriol. 189:5082–5089. 10.1128/JB.00431-07 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Law CJ, Maloney PC, Wang DN. 2008. Ins and outs of major facilitator superfamily antiporters. Annu. Rev. Microbiol. 62:289–305. 10.1146/annurev.micro.61.080706.093329 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Vardy E, Arkin IT, Gottschalk KE, Kaback HR, Schuldiner S. 2004. Structural conservation in the major facilitator superfamily as revealed by comparative modeling. Protein Sci. 13:1832–1840. 10.1110/ps.04657704 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Sauer JD, Bachman MA, Swanson MS. 2005. The phagosomal transporter A couples threonine acquisition to differentiation and replication of Legionella pneumophila in macrophages. Proc. Natl. Acad. Sci. U. S. A. 102:9924–9929. 10.1073/pnas.0502767102 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Marohn ME, Santiago AE, Shirey KA, Lipsky M, Vogel SN, Barry EM. 2012. Members of the Francisella tularensis phagosomal transporter subfamily of major facilitator superfamily transporters are critical for pathogenesis. Infect. Immun. 80:2390–2401. 10.1128/IAI.00144-12 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.von Bargen K, Polidori M, Becken U, Huth G, Prescott JF, Haas A. 2009. Rhodococcus equi virulence-associated protein A is required for diversion of phagosome biogenesis but not for cytotoxicity. Infect. Immun. 77:5676–5681. 10.1128/IAI.00856-09 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.de la Pena-Moctezuma A, Prescott JF. 1995. Association with HeLa cells by Rhodococcus equi with and without the virulence plasmid. Vet. Microbiol. 46:383–392. 10.1016/0378-1135(95)00034-8 [DOI] [PubMed] [Google Scholar]
  • 36.Miranda-Casoluengo AA, Miranda-Casoluengo R, Lieggi NT, Luo H, Simpson JC, Meijer WG. 2013. A real-time impedance based method to assess Rhodococcus equi virulence. PLoS One 8:e60612. 10.1371/journal.pone.0060612 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Hong Y, Hondalus MK. 2008. Site-specific integration of Streptomyces ΦC31 integrase-based vectors in the chromosome of Rhodococcus equi. FEMS Microbiol. Lett. 287:63–68. 10.1111/j.1574-6968.2008.01298.x [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Byrne GA, Boland CA, O'Connell EP, Meijer WG. 2008. Differential mRNA stability of the vapAICD operon of the facultative intracellular pathogen Rhodococcus equi. FEMS Microbiol. Lett. 280:89–94. 10.1111/j.1574-6968.2007.01055.x [DOI] [PubMed] [Google Scholar]

Articles from Infection and Immunity are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES